Labshake search
Citations for Thermo Fisher :
8801 - 8850 of 10000+ citations for Human UFL1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... HEK 293T cells were plated at 60 % confluence in 15 cm plates and transfected with mammalian expression plasmids in OptiMEM media (Invitrogen). 158 ng/cm2 of NSUN4 and MTERF4 plasmid DNA ...
-
bioRxiv - Immunology 2021Quote: HEK293T cells were transiently transfected with plasmids encoding full length SARS-CoV-2 spike variants using lipofectamine 3000 (L3000-001, ThermoFisher) following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA interference plasmids were built using annealed DNA oligonucleotides (Supplementary Note 1) in the pcDNA6.2-GW/EmGFP plasmid (Block-iT™ miRNA expression kit from Invitrogen). Specific primers for pre-miRNA were designed using Life Technologies’ online tool (www.lifetechnologies.com/rnai) ...
-
bioRxiv - Microbiology 2021Quote: ... Calibration curves for 16S rRNA were obtained by serial dilutions of a linearized plasmid (pGEM-T easy, Invitrogen, Carlsbad, USA) carrying a single amplicon variant ...
-
bioRxiv - Microbiology 2021Quote: ... forward and reverse primers with overlapping SARS-CoV-2 spike sequence with the N501Y mutation followed by sequence complementary to the target plasmid (pEP-KanS) were synthesized (Invitrogen). A PCR fragment with overlapping ends carrying SARS-CoV-2 sequence flanking the Kanamycin resistance marker was amplified with the primers described using pEP-KanS as template ...
-
bioRxiv - Microbiology 2021Quote: ... HeLa cells were transfected with 0.25 μg/6 × 104 Hela cells of the myc-Rac1Q61L plasmid with turbofect (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were transfected the following day with 1 μg of MyD88-HA or TRIF-HA plasmids (Carty et al, 2006) diluted in 200 μl of opti- MEM (Gibco) using 6 μ of Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... Transfections were carried out using 1 mg of total DNA (500 μg each of VH and Vκ plasmid DNA) and 1 l of cultured HEK293-F cell suspension maintained in sterile Freestyle 293 expression medium (Invitrogen) without antibiotics at 37 °C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... genes and other genetic elements required to assemble the plasmids were amplified by PCR using PhusionU polymerase (Thermo Fisher Scientific). S ...
-
bioRxiv - Synthetic Biology 2020Quote: ... transfection complexes containing 3 μL of Xtremegene-9 reagent and 500 ng of plasmid DNA were prepared in 100 μL of OptiMEM (Invitrogen). After 20 min of incubation at room temperature ...
-
bioRxiv - Synthetic Biology 2020Quote: ... transfection complexes containing 10 μL of Viafect reagent and 1 μg of plasmid DNA were prepared in 200 μL of OptiMEM (Invitrogen). After 5 min of incubation at room temperature ...
-
bioRxiv - Bioengineering 2020Quote: ... 2013) and co-transfected with plasmids containing Cas9 effectors into A375 or HEK 293FT cells using Lipofectamine 2000 (ThermoFisher 11668019). The transfected cells were selected with 2 μg ml-1 puromycin for 72 h ...
-
bioRxiv - Biochemistry 2021Quote: To each well in the plate was added 25 ng of pMIR-B3GLCT plasmid in 5 μl Opti-MEM (Gibco) and 0.11 μl lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Pathology 2021Quote: ... The cDNA of the fusion chimera termed ace2 1–618-ddc-abd was then inserted into pcDNA3-4 plasmid (Invitrogen) using custom synthesized complementary primers (IDT ...
-
bioRxiv - Cell Biology 2020Quote: ... the packaging construct pCMVD8.9 and the envelope coding plasmid pCMV-VSVG (from Dr. Soosan Ghazizadeh, SUNY Stony Brook) into 293T cells using lipofectamine 2000 (Invitrogen). Supernatant containing the virus was collected after 72 hours and filtered through a 0.22 micron PES (Millipore ...
-
bioRxiv - Neuroscience 2019Quote: The FRT-PGK-em7-Keo-FRT cassette was amplified using high-fidelity PCR from pPKG-em7-Keo-FRT and used for TOPO-TA cloning into the pCRII plasmid (TOPO TA Cloning Kit Dual Promoter, Invitrogen). SYFP2 coding sequence (from pSYFP2-C1 ...
-
bioRxiv - Biophysics 2019Quote: ... In vitro expression of proteins was initiated by adding plasmid (60 nM) to Leishmania extract24 supplemented with RNAse OUT (Invitrogen) and the mixture was incubated in the dark at 28 °C for 2.5 hours ...
-
bioRxiv - Microbiology 2019Quote: ... [48] and four pHW2000 plasmids expressing each of the viral protein components needed to reconstitute RNP complexes using Lipofectamine 2000 (Invitrogen). Triplicate repeats of each assay were performed in parallel at 37.5°C and 35°C ...
-
bioRxiv - Genomics 2019Quote: ... The resulting PCR product (1047 bp long) was cloned between the KpnI and XbaI sites of the pCRII-TOPO plasmid (Invitrogen), to give the pCRII-Dcr1 vector ...
-
bioRxiv - Biochemistry 2019Quote: ... knock-down was performed using a single HELLS siRNA oligonucleotide 24h prior to transfection of pMyc-HELLS plasmid DNA using Lipofectamine 3000 (Invitrogen). Media was changed 6 h after plasmid transfection and cells incubated for 24h prior to irradiation ...
-
bioRxiv - Immunology 2019Quote: ... 5μg filter-sterilized DNA (2.5μg each of heavy and light chain-encoding plasmids) was added to 1mL of Expi293 medium (ThermoFisher Scientific; A1435101) in a fresh tube ...
-
bioRxiv - Neuroscience 2020Quote: ... Q7 and Q111 cells were cotransfected with pNF-kB-Luc and β-galactosidase (β-gal) plasmids using Lipofectamine 2000 (Invitrogen) for 24 hrs ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 100 ng of the effector plasmid (hGli3 WT or F387F*fs) and 20 ng of pRL-SV40 were co-transfected using Lipofectamine 3000 (ThermoFisher). pRL-SV40 coding for Renilla luciferase was used as a transfection control and for normalization ...
-
bioRxiv - Microbiology 2019Quote: HEK293T cells seeded into 96-well plates were co-transfected in triplicate with 100ng plasmid and 3pmol mimic per well using Lipofectamine 2000 (Invitrogen). Twenty hours later ...
-
bioRxiv - Cell Biology 2019Quote: ... The RITE-(V5/MYC) plasmid was created by combining synthesized g-block DNA fragments with a pMT-CID-V5 (Invitrogen) plasmid ...
-
bioRxiv - Microbiology 2020Quote: ... The pSAd36-S and pSAd-control plasmids were linearized with PacI restriction enzyme to liberate viral genomes for transfection into T-Rex 293-HEK cells (Invitrogen). The rescued replication-incompetent ChAd-SARS-CoV-2-S and ChAd-Control vectors were scaled up in 293 cells and purified by CsCl density-gradient ultracentrifugation ...
-
bioRxiv - Genomics 2021Quote: ... cells were co-transfected with 250 ng of luciferase reporter plasmid and 1 µg of either mChy-ICP4 or mChy-NLS using Lipofectamine 3000 reagents (ThermoFisher) per the manufacturer’s recommendation ...
-
bioRxiv - Immunology 2021Quote: Codon-optimized sequences for the N or the spike S protein of SARS-CoV-2 were cloned into the pVAX1 expression plasmid (ThermoFisher) optimized for DNA vaccinations referred to as pVAX1-SARS2-N and pVAX1-SARS2-S 81 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Plasmid clone isolates of amplicon DNA were prepared using a Zero Blunt™ TOPO™ PCR cloning kit (K287520, Invitrogen) and their inserts were sequenced ...
-
bioRxiv - Cell Biology 2021Quote: ... sgRNA expression plasmids were linearized with Dra I and used as templates for in vitro transcription using the MEGAshortscript Kit (AM1345, Ambion). Transcribed Cas9 mRNA and sgRNA were both purified by using the MEGAclear Kit (AM1908 ...
-
bioRxiv - Cell Biology 2020Quote: ... Full-length open reading frames were cloned from MORF plasmids (Gelperin et al., 2005) into pDEST-AD2 or pDEST-BD2 using Gateway cloning (ThermoFisher). For truncations of ASE1 ...
-
bioRxiv - Cell Biology 2020Quote: ... NotI-linearized plasmids were purified (QIAquick Gel Extraction Kit) and the 5’-capped mRNAs were synthesized using SP6 mMessenger mMachine kit (Ambion). For GFP-centrin ...
-
bioRxiv - Cell Biology 2021Quote: ... HEK293T cells were transfected with lentiviral vectors together with the packaging plasmids pMD2.G (addgene, #12260) and psPAX2 (addgene, #12259) using lipofectamine 3000 (Invitrogen). Supernatants containing lentivirus were harvested at 48 hr and 72 hr after transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... HEK293 cells were grown on coverslips in 6 well dishes and transfected with pcDNA3.1-3XFLAG-ZNF507 plasmid using lipofectamine reagent (Thermo Fisher). After 36 hours cells were fixed with 4% paraformaldehyde in PBS for 10 minutes at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... Tetracycline-inducible cell lines were generated by stable integration of pcDNA5-based constructs into the FRT site upon co-transfection with pOG44 plasmid (Invitrogen). HeLa FRT cells (Hafner et al. ...
-
bioRxiv - Biochemistry 2020Quote: pX458-POR plasmid was transfected into cells seeded in six-well plates using the transfection reagent (Lipofectamine 3000, Thermo Fisher) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... ∼0.6 × 106 C3H/10T1/2 cells were seeded per well in 12-well dishes and transfected the following day with 0.8-1.6 µg of plasmid using 4 µL Lipofectamine 2000 (Invitrogen, 11668-019) and Opti-MEM (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: Routine cell transfection of HEK293T and HeLa cells with plasmids was conducted using Lipofectamine 2000 and Lipofectamine LTX (Life Technologies), respectively ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were transfected with either 5μg of GFP tagged empty vector or human IL-1β plasmid along with 3μg of psPAX2 and 2ug of pMD2.G using 30μl of lipofectamine 2000 reagent (Invitrogen, 11668-019). 48 hours post transfection lentivirus enriched medium was collected by centrifugation at 2000 rpm for 10 min and filtered through 0.45 μm sterile syringe filters (VWR International ...
-
bioRxiv - Microbiology 2021Quote: ... were seeded into one well of a six-well plate and were transfected with 600 ng of plasmid with 5 μL of Lipofectamine 2000 (Invitrogen) in 200 μL of OptiMEM (Gibco) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 ng of the Renilla Luciferase internal control plasmid (pRT-TK) were co-transfected by the Lipofectamine 2000 Reagent (Invitrogen). Forty-eight hours after plasmid transfection ...
-
bioRxiv - Biochemistry 2021Quote: Renilla luciferase plasmids were transfected as described above and total RNA was extracted after 24 hours using Tri reagent (Invitrogen). 5’ RACE was performed with the 5’ RACE kit (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: ... The linearized plasmid was transcribed in vitro based on the procedures of mMessage mMachine T7 Ultra Kit (Thermo Fisher Scientific). DNAse-treated and poly(A)-tailed Cas13d mRNA was purified by using Mega-Clear Kit (Thermo Fisher Scientific).
-
bioRxiv - Bioengineering 2020Quote: ... 100μl of the cells that grew after transformation with the pMTnCreGm plasmid had their genomic DNA isolated via the MasterPure Genomic DNA Extraction Kit (Invitrogen). Oligos described in Suppl ...
-
bioRxiv - Cell Biology 2021Quote: ... 2.5 µg plasmid DNA and 5 µl TransIT-2020 reagent were added into 250 µl of Opti-MEMI Reduced-Serum Medium (Gibco). After adding the mixture into each well ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Cells were isolated by centrifugation (4,000 × g at 4°C for 15 min) and plasmid DNA isolated using a GeneJet mini-prep kit (ThermoFisher, UK) following manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2021Quote: ... were transfected with 1 µg pNL4-3 Luc.R-E- (or pHIV-1NLΔEnv-NanoLuc) in the presence or absence of 0.3 µg pIR-2019-nCoV-S V5 plasmids using Lipofectamine-3000 (Life Technologies). In certain experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4 μg of plasmid VSV-G encoding G glycoprotein of vesicular stomatitis virus(VSVG) using Lipofectamine 3000 Reagent (Invitrogen). 12 h later ...
-
bioRxiv - Microbiology 2021Quote: ... and zomBRV: atatggatccattttcttatcttatagattctaaaatac (BamHI, Tm 63.7) and cloned into the pVA838 plasmid [20] using MAX Efficiency™ DH5α Competent Cells (Invitrogen) to make pVA838-zomB ...
-
bioRxiv - Immunology 2021Quote: For the antibodies, plasmids encoding heavy and light chains of antibodies (CR3022, and SR1-SR5) were co-transfected into Expi293F cells (ThermoFisher) according to the manufacturer’s instructions for expression of antibodies ...