Labshake search
Citations for Thermo Fisher :
9051 - 9100 of 10000+ citations for Human UFL1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: Linearized plasmids were used as template for in vitro synthesis of mRNA using the SP6 m message machine kit (Ambion) and purified using the Megaclear Kit (Life technology Ambion).
-
bioRxiv - Cell Biology 2023Quote: ... with 7,5 ng of PLOD2 plasmid (CMV PLOD2) (pRP[Exp]-mCherry-CMV>mPLOD2 [NM_001142916.1], Vector Builder) using Lipofectamine reagent (Life Technologies, Courtaboeuf) following to the supplier’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR amplicons were cloned into the plasmid of the Zero Blunt TOPO PCR cloning kit (450031, Thermo Fisher Scientific) and sequenced ...
-
bioRxiv - Genomics 2022Quote: ... We transfected 1.2 million cells with 5μg plasmid DNA per replicate using the Neon Transfection System 100 μL Kit (Life Technologies #MPK10025). RNA was harvested 72 hours after transfection using the Monarch Total RNA Miniprep Kit (NEB #T2010) ...
-
bioRxiv - Cell Biology 2023Quote: ... were co-transfected with eGFP-TDP-43 WT and mScarlet-Ataxin-2 polyQ variants or control plasmid (total DNA =1.5μg) using Lipofectamine 2000 (Thermo Fisher Scientific).
-
bioRxiv - Developmental Biology 2023Quote: ... Cells at 70– 90% confluency were transfected with equal amounts of luciferase reporter and gene expression plasmids using Lipofectamine 3000 (ThermoFisher). Luciferase activity in the cell lysates was measured using a Dual-Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: ... The mRNA from plasmid #1 and #2 was transcribed using the mMESSAGE mMACHINE SP6 Transcription Kit (Thermo Fisher Scientific, AM1340) and purified with the NucleoSpin RNA Clean-up XS kit (Macherey-Nagel ...
-
bioRxiv - Immunology 2023Quote: Retrovirus was generated by transfecting BHK cells (ATCC) or Phoenix cells (laboratory stocks) with 1-4 μg plasmid using the Lipofectamine 2000 Transfection Reagent (Invitrogen). Supernatants were collected at 24 and 48 hours post-transfection and added to MEFs pre-cultured in six-well plates ...
-
bioRxiv - Developmental Biology 2023Quote: ... 200,000 cells were electroporated with 500 ng PX459 and 1000 ng of homology donor plasmid in 10 µl electroporation buffer R using the Neon Transfection System (Invitrogen) with one pulse of 1400 V and a pulse width of 20 ms ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA constructs were inserted in TOPO II PCR-plasmids and using TOPO TA Cloning kit with chemically competent cells according to manufacturer’s protocol (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... 2.5x106 TCR-deficient Jurkat or SKW-3 cells were electroporated with plasmid DNA using the Neon Transfection system (Thermo Fisher). Single-cell clones were expanded under selection (8 or 10 µg mL-1 blasticidin ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with the indicated plasmids routinely using 1 μg of DNA mixed with 3 μl of Lipofectamine 2000 (Invitrogen) in Optimem (Gibco) ...
-
bioRxiv - Cell Biology 2023Quote: ... The TALEN expression plasmids were linearized with BamHI and then used for in vitro transcription (mMESSAGE mMACHINE T3 kit, Ambion). Approximately 1 nL of TALEN messenger ribonucleic acid (mRNAs ...
-
bioRxiv - Molecular Biology 2023Quote: ... U2-OS-DR-GFP cells were co-transfected with an I-SceI plasmid plus the indicated expression vector or siRNA using Lipofectamine 2000 (Invitrogen) for 72 h ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... together with psPAX2 packaging and pMD2.G envelope plasmid DNA were co-transfected to HEK293T cells using Lipofectamine 3000 (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... Neonatal HDFs were seeded in 6-well plates and transfected with 500ng of each plasmid per well using Lipofectamine 3000 (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Lenti-X 293T cells were transfected with pCDNA3.1 plasmids expressing HA-tagged YWHA isoforms using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s protocol and cultured for 48 h before lysis in 2% SDS buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... 7.5 μg of each sgRNA containing plasmid (15 μg in total) were transfected together with 24 μl lipofectamine (Invitrogen 18324012) in 5 ml fresh complete medium overnight ...
-
Quantitative Comparison of Presenilin Protein Expression Reveals Greater Activity of PS2-γ-SecretasebioRxiv - Cell Biology 2023Quote: ... When cells were at approximately 80% confluency 1.25 µg each of the CRISPR/Cas9 KO and HDR plasmids were transfected using Lipofectamine 3000 (Invitrogen L3000015) and cells transfected as per manufacturer instructions ...
-
bioRxiv - Cell Biology 2023Quote: Cells were transfected with MeCP2-EGFP with or without CHD-mCherry plasmid using Lipofectamine 3000 (Thermo Fisher Scientific cat. L3000008) and following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... The cloned gRNA vector (3 μg) and Cas9 plasmid vector (1 μg) were co-transfected into 1x106 mESCs using Lipofectamine 3000 reagent (#L3000-001, Invitrogen). After 24 hours ...
-
bioRxiv - Microbiology 2023Quote: ... and mCitrine fluorescent protein were amplified from plasmid pOXC101 (Pollak et al 2021) with the Phusion High-Fidelity PCR Master Mix (ThermoFisher) using primers JES003 (ATATCTCGAGGGCGCGCCTTGACAATTAATC ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were seeded on 60 mm culture dishes one day prior to transfection and transfected with LRFN2 and TRPM1 expression plasmids using jetPrime reagent (Polyplus transfection) or Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... HEK-293T cells were seeded in 6-well plates the day before transfection with the WSN reverse genetics plasmids in Opti-MEM (Gibco) using FuGene®6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... and the cRNA was generated from each plasmid by using an RNA preparation kit (mMessage mMachine T7 Transcription Kit; Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... was used to transfect 0.375 ug of plasmid DNA per mL of Opti-MEM + GlutaMAX (+HEPES + 2.4g/L Sodium Bicarbonate; GIBCO, Life Tech). After 7-16 hours ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... approximately 2 kb of DNA upstream of the start codon of the lhfpl5b gene was cloned into the p5E plasmid of the recombination-based multisite Gateway cloning system (ThermoFisher). A Tol2 transposon backbone was then used to create the injectable expression plasmid lhfpl5b2028:ChR2-EYFP-PA ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK293T cells were transfected with the plasmid pCAG-ss-AF-3XHA-TEVcs-HALOTag using Lipofectamine 2000 (Invitrogen, Cat# 11668-019) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... HEK293T cells were seeded in a 10 cm dish and transfected with 12 μg pcDNA3.1 Spike plasmid using Lipofectamine 2000 (Thermo Fisher). Forty-eight hours after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... 1µg of pBabe-puro or -neo plasmid DNA encoding the protein of interest was transfected into the attached Phoenix cells using Lipofectamine 3000 (ThermoFisher) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were transfected with a GFP-tagged plasmid vector expressing spCas9 and gRNA using Lipofectamine 3000 Transfection Reagent following manufacturer’s protocol (ThermoFisher Scientific). Cells were then sorted based on GFP expression after 48 hours from the transfection.
-
bioRxiv - Cell Biology 2023Quote: ... 2.5×105 Tet-mCherry-CENP-A HeLa-TRex cells were transfected with 1ug of either CENP-C-LAP or empty vector plasmid in 6-well plates with Lipofectamine 3000 (Invitrogen) according to manufacturer protocol ...
-
bioRxiv - Biochemistry 2023Quote: Plasmids for recombinant protein expression were constructed using mega primer insertion PCR [64] using the plasmid Champion pET303/CT-His vector (Invitrogen). The double-stranded DNA inserts (Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µM of GFP and sh-RNA containing plasmids were co-transfected into primary cultured neurons with lipofectamine 2000 (Invitrogen), according to the manufacture protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lentiviral particles were produced by co-transfection of the sgRNA library with lentiviral packaging plasmids pMD2G and psPAX2 in HEK293T/17 cells using Lipofectamine 3000 (Invitrogen). pMD2.G and psPAX2 were gifts from Didier Trono (Addgene plasmid #12259 and #12260) ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected with siRNA or plasmids for desired time as detailed in the figure legends using Lipofectamine 3000 (L3000015, Invitrogen).
-
bioRxiv - Neuroscience 2023Quote: ... and we amplified these plasmids in either pSMART-HC-Kan or pAAV backbone using Stbl3 cells (Thermo Fisher Scientific # C737303). For in house preps ...
-
bioRxiv - Microbiology 2023Quote: ... and transfected with 50 ng of pcDNA3.1-SC2-spike and 50 ng of pCG1-ACE2 plasmid using Lipofectamine 2000 (Invitrogen™) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Stable cell lines were generated by transfecting 1μg of ePB plasmid encoding localized APEX2 with 1μg of pTransposase plasmid46 using Lipofectamine 2000 (Invitrogen, cat. #11668027). Cells underwent selection with 2μg/ml Puromycin (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells transfected directly with the retroviral expression plasmid by calcium-phosphate co-precipitation according to the manufacturer’s protocol (Thermofisher Scientific). Briefly ...
-
bioRxiv - Biochemistry 2023Quote: ... The resulting plasmid was utilized for the generation of recombinant Baculoviruses according to the Bac-to-Bac expression system protocol (Invitrogen). Exponentially growing Sf9 cells (2 x 106 cells/mL in Lonza Insect-XPRESS medium supplemented with 0.1 mM biotin ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were then transfected with the siRNA for knockdown or plasmid DNA for overexpression using lipofectamine 3000 (Life Technologies) according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... These plasmids were used for the generation of recombinant baculoviruses following Bac-to-Bac expression system protocols (Invitrogen, Catalog # 10359016).
-
bioRxiv - Biophysics 2023Quote: CV1 cells were transfected with mScarlet-CD4-PhoCl-RER and rtTA3 plasmids using the Neon Transfection System (Thermo Fisher Scientific) 24 hours before the experiment ...
-
bioRxiv - Biochemistry 2023Quote: Monolayers of HEK293T cells cultivated on coverslips were co-transfected with equimolar amounts of SIDT1/2-GN and SIDT1/2-GC plasmids using Lipofectamine 3000 (Invitrogen). After 24 hours of transfection ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.5 µg scIHF2 expression vector with or without 0.5 µg Int-C7 plasmid) and Lipofectamine 2000 were incubated separately in 50 µl of Opti-MEM medium (Life Technologies). The lipid complexes were prepared by mixing DNA and Lipofectamine 2000 reagent and incubating for 20 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells were transfected with 20 ng of PER and 100 ng of CK1ε expression constructs with pCS2 empty vector to a total of 1 µg plasmid with Lipofectamine 2000 (Invitrogen) as per manufacturer’s direction.
-
bioRxiv - Biophysics 2023Quote: ... For expression in Xenopus laevis oocytes (EcoCyte Bioscience, Austin, TX) cRNA for each construct was generated from DNA plasmids (mMessage mMachine T7, Ambion). Oocytes were injected with 27–54 ng of total mRNA for α ...
-
Activation of glucocorticoid receptor signaling inhibits KSHV-induced inflammation and tumorigenesisbioRxiv - Cancer Biology 2023Quote: ... Lentivirus was produced by transfecting the expression plasmid with p8.74/pMDG lentiviral packaging system into 293T cells using the Lipofectamine 2000 Kit (Invitrogen, 11668019). Supernatant containing the lentivirus was harvested at 48 and 72 h post-transduction ...
-
bioRxiv - Neuroscience 2023Quote: DIV 12-14 hippocampal neurons were transfected with plasmid DNA and/or miRDIAN miRNA inhibitors (Horizon) using Lipofectamine 2000 (Invitrogen) and used for experiments at DIV14-16.