Labshake search
Citations for Thermo Fisher :
8451 - 8500 of 10000+ citations for EnzyFluo ERK Phosphorylation Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: Western blotting of whole cell extracts prepared in Triton-X-100 lysis buffer and quantified using the BCA assay kit (#23225; Thermo Fisher Scientific) was performed as described previously [27] ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein concentrations in both the cytosolic and membrane-enriched fractions were estimated using the Micro BCA™ Protein Assay Kit (Cat no. 23235, Thermo Scientific). Equal amounts of protein samples were separated by SDS-PAGE ((4-20% ...
-
bioRxiv - Bioengineering 2024Quote: To measure the mOx40L protein abundance in EVs the Mouse TNFSF4 solid-phase sandwich ELISA (enzyme-linked immunosorbent assay) kit (Invitrogen, Thermo Fisher Scientific) was used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... GCACGAAGGAGCACAAAACGAAGCAAUGGAUGGUAUGUCAGUGAGGUGGAAAGA GUUCAGGUGCACG The synthetic RNA was diluted in nuclease free water and the following concentrations were confirmed with Qubit RNA Broad Range Assay Kit (Thermo Fisher Scientific): 10 ng/ul ...
-
bioRxiv - Molecular Biology 2024Quote: TUNEL assays were performed on deparaffinized heart sections using a Click-iT™ Plus TUNEL Assay Kits for In Situ Apoptosis Detection (Invitrogen, C10617), according to the manufacturer’s instruction ...
-
bioRxiv - Immunology 2024Quote: ... cells were collected at 24 h post-transfection and luciferase activity was analyzed by Dual-Luciferase Reporter Assay Kit (Vazyme) performed with a Luminoskan Ascent luminometer (Thermo Fisher Scientific). The activity of Firefly luciferase was normalized by that of Renilla luciferase to obtain relative luciferase activity.
-
bioRxiv - Biochemistry 2024Quote: ... and supernatants were sampled and diluted 30-fold for calculation of the protein concentration using the Coomassie Plus Staining Reagent (Bradford) Assay Kit (Thermo Fisher Scientific). Cell lysates were normalized for total protein concentration and processed for immunoblotting or immuno-precipitation (IP).
-
bioRxiv - Biochemistry 2024Quote: ... The concentrations of the soluble fractions of the crude extracts were measured using Pierce Bradford Assay Kit (Thermo Fisher Scientific, USA, #23246). All samples were adjusted to a concentration of 200 ng/µL ...
-
bioRxiv - Neuroscience 2024Quote: Single-molecule fluorescence in situ hybridization (smFISH) for miRNA detection in hippocampal neuron cultures was conducted using the QuantiGene ViewRNA miRNA Cell Assay Kit (Thermo Fisher, QVCM0001) following the manufacturer protocol with minor adjustments ...
-
bioRxiv - Neuroscience 2024Quote: ... The protein concentrations of the lysed sEV preparations were determined using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, USA), according to the provided guidelines ...
-
bioRxiv - Molecular Biology 2024Quote: ... We measured the total protein content in the prepared seeds by BCA quantification (Micro BCA™ Protein Assay Kit, Thermo Fisher Scientific). 2% (w/w ...
-
bioRxiv - Plant Biology 2024Quote: ... The amount of RNA was quantified using a Qubit Fluorometer 3.0 and the “Qubit RNA Broad Range Assay Kit” (Invitrogen, Carlsbad, CA, USA). RNA purity (260/230 nm and 260/230 nm ratios ...
-
bioRxiv - Bioengineering 2024Quote: The loading efficiency (LE) of NAs within the various nanocarriers was determined with the Quant-itTM RiboGreen RNA Assay Kit (Thermo Fisher Scientific) according to manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell lysates were centrifuged at 15,000 x g at 4°C for 20 min and protein concentration was quantified using bicinchoninic acid (BCA) assay kit (Thermo Fisher Scientific). 10-25 µg of proteins were resolved in 8% SDS-PAGE gels before being transferred onto polyvinylidene (PVDF ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells underwent Click-iT EdU staining according to the manufacturer’s protocol (Click-iT EdU Flow Cytometry Assay Kits, Invitrogen, Cat No. C10425). Flow cytometry analysis was conducted on a BD Canto II analyzer to assess the proliferation by evaluating 50,000 events per sample ...
-
bioRxiv - Genomics 2024Quote: The quality-compliant DNA was further tested for purity and integrity using 0.8% agarose gel electrophoresis and a Qubit dsDNA HS Assay Kit on a Qubit 3.0 Fluorometer (Life Technologies, Carlsbad, CA, USA). RNA contamination was identified using a 1.5% agarose gel ...
-
bioRxiv - Microbiology 2024Quote: ... The basolateral media harvested at the end of the infection was also used for measuring LDH by using the Invitrogen™ CyQUANT™ LDH Cytotoxicity Assay Kit (Invitrogen), in technical triplicates ...
-
bioRxiv - Microbiology 2024Quote: ... Cell debris were pelleted by centrifugation for 20 min at 4 °C and 20,000 x g and the total protein concentration of the cleared lysate was determined using the Pierce Rapid Gold BCA Protein Assay Kit (Thermo Scientific, #A53225) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The concentration of dsDNA in each library was measured using the fluorometric Qubit 1X dsDNA HS Assay Kit (Thermo Fisher Scientific, Q33231) after the individual indexed libraries had been purified.
-
bioRxiv - Molecular Biology 2024Quote: ... The level and integrity of RNA in each sample were evaluated using a Qubit RNA Assay Kit on a Qubit 2.0 Fluorometer (Life Technologies, CA, USA) and RNA Nano 6000 Assay Kit with the Bioanalyzer 2100 system (Agilent Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... the amount of DNA in each sample was measured using the Qubit dsDNA HS assay kit with the Qubit fluorometer (Invitrogen; Waltham, MA). The DNA was stored in a - 20C freezer ...
-
bioRxiv - Neuroscience 2024Quote: ... Total protein concentration of Triton X-100 soluble and insoluble fraction was determined using BCA Protein Assay Kit (Thermo Fisher Scientific Inc).
-
bioRxiv - Genomics 2024Quote: ... Equal volumes were pooled into final libraries that were quantified using a Qubit ssDNA assay kit (Thermo Fisher Scientific, Waltham, MA, USA) and then by real-time PCR against a standard curve using the KAPA Library Quantification Kit (Kapa Biosystems/Roche ...
-
bioRxiv - Genomics 2024Quote: ... The DNA concentration (PCR products and DNA libraries) was measured using the Qubit dsDNA HS Assay Kit for fluorometric DNA measurement (Thermo Fisher Scientific) on a Qubit 4.0 Fluorometer ...
-
bioRxiv - Cell Biology 2024Quote: ... Lysates were cleared by centrifugation and diluted to equal total protein concentrations following analysis using Pierce BCA protein assay kit (Thermo Fisher Scientific). Prior to loading on gels ...
-
bioRxiv - Cell Biology 2024Quote: ... each library was evaluated using a Thermo Fisher Scientific Qubit 4.0 fluorometer with the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific, Q32854) and an Agilent Fragment Analyzer (Agilent ...
-
bioRxiv - Genomics 2024Quote: ... The concentration of DNA was measured with the Qubit® DNA Assay Kit in a Qubit® 2.0 Fluorometer (Life Technologies, USA). For RNA extraction ...
-
Autophagy suppression in DNA damaged cells occurs through a newly identified p53-proteasome-LC3 axisbioRxiv - Cell Biology 2024Quote: ... The concentrations of each of the purified subunits were then determined using a BCA Protein Assay Kit (#23225, Thermo Fisher Scientific, USA). Eluted subunits were then diluted to 100 μg/mL with 8 M urea solution ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and then normalized to the concentration of total proteins assessed by using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific).
-
bioRxiv - Synthetic Biology 2024Quote: ... Samples were diluted to a final concentration of ~2 nM after they were quantified using the Qubit dsDNA HS Assay kit (Invitrogen, Catalog #Q33231). The libraries were then run on either an Illumina MiSeq using a standard 300-cycle kit or an Illumina NextSeq 500 or an Illumina NextSeq 2000 using a mid-output 300-cycle kit using standard protocol.
-
bioRxiv - Microbiology 2024Quote: ... The amount of genomic DNA was then quantified by measuring the fluorescence with the Qubit™ dsDNA BR Assay Kit (Invitrogen, USA) on a QubitTM 2.0 Fluorometer (InvitrogenTM by Life TechnologiesTM ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein concentrations of both the cytosolic and membrane fractions were measured using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific) and equal amounts of protein were loaded on to a NuPAGE 4-12% Bis-Tris gel (Invitrogen) ...
-
bioRxiv - Immunology 2024Quote: ... Click labelling was then performed with the Click-iT™ Plus OPP Alexa Fluor 647 Protein Synthesis Assay Kit (ThermoFisher, cat: C10458). NP binding was determined by incubation with NP-PE (Biosearch ...
-
bioRxiv - Immunology 2021Quote: ... PD-L1 mRNA expression was quantified using a TaqMan Gene Expression assay (ThermoFisher Scientific, Assay Id: Hs01125301_m1) on a Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 μl of the supernatant was then used for the assay with Amplex Red Assay (Life Technologies) according to the producer’s instruction ...
-
bioRxiv - Physiology 2021Quote: ... IL-6 (assay ID: HS00985639_m1) and TNF-α: (assay ID: HS00174128_m1) following manufacture’s protocol (Thermo Fisher Scientific). 18s (assay ID ...
-
bioRxiv - Genetics 2021Quote: ... and RNA levels were determined via TaqMan qPCR assays for mouse Pycard (ThermoFisher, 4441114, Assay ID: AJMSHN7), with Actb (ThermoFisher ...
-
bioRxiv - Neuroscience 2020Quote: ... 2.5 μL of cDNA and 2.5 μL of Assay Mix (TaqMan Gene Expression Assays from Applied Biosystems; GAPDH ...
-
bioRxiv - Microbiology 2019Quote: The lysate protein concentration was determined via bicinchoninic acid assay (BCA assay) according to manufacturer’s directions (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... pDEST-AD-CYH2 (assay version 1) and pDEST-AD-AR68 (assay version 3) using Gateway Technology (Invitrogen). Attributes of these plasmids are summarized in Suppl ...
-
bioRxiv - Neuroscience 2023Quote: ... ε4) and rs7412 (ε2 vs. ε3/ε4) were genotyped using assay C_3084793_20 and assay C_904973_10 (Thermo Fisher), respectively ...
-
bioRxiv - Biochemistry 2022Quote: ... The concentrations of actin and other proteins in the assay were determined by Bradford protein assay (ThermoFisher) using bovine serum albumin (BSA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... targeting human SLC22A10 (Assay ID: Hs01397962_m1) and beta actin (Assay ID: Hs99999903_m1) (Applied Biosystems, Foster City, CA). The qRT-PCR reactions were conducted in a 96-well plate ...
-
bioRxiv - Immunology 2023Quote: ... inner salt] cell proliferation and viability assays (CellTiter 96® AQueous One Solution Cell Proliferation Assay, Invitrogen) were performed according to the manufacturer’s instructions with 50 000 cells per well and read at 492nm on a microplate absorbance reader (Multiskan FC microplate photometer ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein concentration was assessed either with Bradford’s assay or with EZQ protein quantification assay (Thermo Fisher Scientific) and then kept at −80°C until further processing ...
-
bioRxiv - Developmental Biology 2023Quote: ... or snoRNA202 (assay ID: 001232) and snoRNA234 (assay ID: 001234) for mECs (all from Thermo Fisher Scientific) (Wong et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The final library size distribution was validated with capillary electrophoresis and quantified with a Quant-iT PicoGreen dsDNA Assay Kit (Thermo Fisher Scientific, P11496) and qPCR ...
-
bioRxiv - Cell Biology 2020Quote: Cell proliferation in culture was measured by the CyQUANT® cell proliferation assay kit as per the protocol described by the provider (Thermo Fisher scientific). In brief ...
-
bioRxiv - Cell Biology 2020Quote: SA-β-gal levels in the chondrocytes after senescence induction and monolayer culture were evaluated using the CellEvent™ Senescence Green Flow Cytometry Assay Kit (C10840; Thermo Fisher Scientific). The working solution was prepared by diluting the CellEvent™ Senescence Green Probe (1,000X ...
-
bioRxiv - Immunology 2021Quote: Bone marrow B factions were sorted and calcium influx was assayed with a Fluo-4 Direct™ Calcium Assay Kit (ThermoFisher cat# F10471). Briefly cells were incubated with Fluo-4 Direct™ at 37°C for 1 hour ...