Labshake search
Citations for Thermo Fisher :
7701 - 7750 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Fast DiI (1,1′-dilinoleyl-3,3,3′,3′-tetramethylindocarbocyanine, 4-chlorobenzenesulphonate, D7756, Invitrogen) to back label parasympathetic preganglionic neurons (PPNs ...
-
bioRxiv - Cell Biology 2024Quote: ... organoids were washed 3 times with ice-cold PBS (Gibco, #14190250) and kept on ice for the entire isolation procedure ...
-
bioRxiv - Plant Biology 2023Quote: ... on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific). The data were normalized using actin (Solyc11g005330 ...
-
bioRxiv - Cancer Biology 2024Quote: ... via cytocentrifugation on a Shandon Cytospin 3 Cytocentrifuge (Thermo Fisher Scientific) at 500g for 5 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μg/ml anti-CD3 (Thermo Fisher Scientific, 16-0032-82) and 5 μg/ ml anti-CD28 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by 3 PBS washes and mounting using ProLong Gold (Invitrogen) and 18mm square glass coverslips ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were passaged every 3-4 days with TrypLE (12604013, Gibco). Cells were authenticated by STR and tested for mycoplasma annually through Genetica Inc a subdivision of LabCorp.
-
bioRxiv - Cell Biology 2024Quote: ... and 3% THE RNA Storage Solution (Thermo Fisher Scientific, Cat # AM7001) dissolved entirely in molecular H2O ...
-
bioRxiv - Microbiology 2024Quote: ... or a QuantStudio 3 (Thermo Fisher Scientific, Inc., Waltham, MA, U.S.A.) with two primers and probes consisting of the forward primer (5’-TGC TCA TGG TAT CAA TCT TAT CG −3’) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were fixed in 3% paraformaldehyde (PFA; #043368.9M, Thermo Fisher Scientific) for 10 min at room temperature (RT ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were detected using a QuantStudio 3 (Thermo Fisher Scientific) qPCR machine ...
-
bioRxiv - Immunology 2024Quote: ... were coated with 3 µg ml-1 of streptavidin (Thermo Fisher) diluted in carbonate-bicarbonate buffer (E107 ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated with TO-PRO™-3 Iodide (Invitrogen, UK) for 15 min and mounted using ProLong Glass Antifade Mountant (Thermo Fisher ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5’- TTGGATCAGCTCAGACATATT-3’ or a nonspecific “scrambled” control (Invitrogen, United States). 72 hours after transfection ...
-
bioRxiv - Immunology 2024Quote: ... cells were washed 3 times with PBS (Gibco Life Technologies,10010) for 5 min ...
-
bioRxiv - Immunology 2024Quote: ... cells were washed 3 times with PBS (Gibco Life Technologies,10010) for 5 min ...
-
bioRxiv - Genetics 2024Quote: ... and QuantStudio™ 3 Real-Time PCR System (Thermo Fisher Scientific). Primers for amplifying mtDNA were AGCTCATCATATATTTACCGTTGGA & AGCTGGAGAATAAGAAA-GTTGAGT ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were run on NuPAGE 3-8% Tris Acetate Gel (Invitrogen) in Tris-Acetate SDS Running Buffer (Novex) ...
-
bioRxiv - Immunology 2024Quote: ... CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher, C10423) was added to cultures at 20 μM and incubated for 30 min at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... and plates were blocked with 3% non-fat milk (Life Technologies) diluted in PBS containing 0.01% Tween-20 (PBST ...
-
bioRxiv - Microbiology 2024Quote: ... The qPCR reactions were run on a QuantStudio 3 (Applied Biosystems). The data were normalized using a standard curve from gDNA extracted from purified EBs.
-
bioRxiv - Microbiology 2023Quote: ... The first method was staining with DiIC12(3) dye (Thermo Fisher). Five milliliters of overnight B ...
-
bioRxiv - Genetics 2023Quote: ... Mixtures of 3 RNAi directed against ATR (HSS100876, HSS100877, HSS100878, Invitrogen), CHK1 (HSS101854 ...
-
bioRxiv - Genomics 2023Quote: ... The library was quantified with a Qubit 3 fluorometer (Invitrogen Q33216) and its size was assessed with the Agilent Femto Pulse ...
-
bioRxiv - Immunology 2023Quote: ... counted using a Countess 3 cell counter (Thermo Fisher Scientific #A49865) and concentration was adjusted to 3,000-5,000 nuclei/µL.
-
bioRxiv - Systems Biology 2023Quote: ... The supernatant was mixed with 3 µL GlycoBlue co-precipitant (Invitrogen), 1:10 volume of 3 M sodium acetate ...
-
bioRxiv - Neuroscience 2023Quote: ... and cultured for 3 days in DMEM/F12-Glutamax medium (Gibco) containing 1% N2 supplement (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative PCR was performed on the QuantStudio 3 instrument (Thermo Fisher), using SYBR Green PCR master mix (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Slides were incubated in 3% H2O2 (ThermoFisher Scientific; Catalog #H325-500) for 15 min to quench endogenous peroxidase activity ...
-
bioRxiv - Immunology 2023Quote: ... on a QuantStudio 3 Real-Time PCR System (Applied Biosystems, A28567). Primers for Nos2 and B2m were designed using NCBI PrimerBlast84 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Afterwards 3 volumes of Trisol LS reagent (ThermoFisher Scientific, 10296-028) was added ...
-
bioRxiv - Microbiology 2023Quote: Quantitative RT-PCR (QuantStudio 3, Applied Biosystems, Foster City, CA, USA) was performed using one-step Prime script III RT-qPCR mix (Takara Bio ...
-
bioRxiv - Genomics 2022Quote: ... at a 1:3 ratio in Opti-MEM medium (Gibco, 11524456), incubated for 15 minutes at room temperature and added dropwise to the cells ...
-
bioRxiv - Microbiology 2023Quote: ... AmpB (3 mg/kg/d; diluted in sterile saline; AmpB; Gibco), PEA (0.5 mg/kg/d ...
-
bioRxiv - Genomics 2023Quote: ... Quality check of HMW DNA included fluorometric (Qubit v.3, Invitrogen) quantification of concentration ...
-
bioRxiv - Cell Biology 2023Quote: ... 9 was performed using a QuantStudio™ 3 (Thermo Fisher Scientific) with an Applied Biosystems PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... plates were rinsed with 2-3 ml of PBS (Gibco, #10010023) and treated with 0,5 mL ReLeSR (Stemcell technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein lysates were resolved on 3-8% (Thermo Fisher Scientific EA0375BOX) or 4-12% gradient SDS-PAGE gels (Thermo Fisher Scientific NP0321BOX) ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using TryplE (Gibco 12604054). Naïve and primed hPSCs were expanded and induced into different lineages in a 5% CO2 incubator at 5% O2 at 37C.
-
bioRxiv - Genomics 2023Quote: ... on a QuantStudio 3 real-time PCR system (Thermo Fisher Scientific), as described previously (68) ...
-
bioRxiv - Biochemistry 2023Quote: Pierce™ RNA 3’ Ed Biotinylation Kit (ThermoFisher, cat. no. 20160) was used to label the 3’ end of 1-kb RNA duplexes (produced as described above ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... a mouse anti-beta 3 tubulin antibody (Invitrogen, MA1-118,1:200) was used.
-
bioRxiv - Cell Biology 2023Quote: ... D × 50-mm length C18/3 μm column (Thermo Fisher Scientific) using a 20 min/5%–90% acetonitrile gradient in 0.2% formic acid at 60 μL/min ...
-
bioRxiv - Developmental Biology 2023Quote: ... brains were embedded in 3% low melting point agarose (Invitrogen, 16520100) and cut on a vibratome into 250 μm-thick slices ...
-
bioRxiv - Neuroscience 2023Quote: ... or CRMP2 siRNA (5′ GTAAACTCCTTCCTCGTGT-3′; obtained from Thermo Fisher Scientific) using the 4D-Nucleofector (P3 Primary Cell Solution ...
-
bioRxiv - Microbiology 2023Quote: ... the concentration determined using Spectronic BioMate*3 UV spectrophotometer (Thermo Scientific) and 500 ng RNA was used as the template for cDNA synthesis ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and plastic two-piece 3-mL syringes from Thermo Scientific (Canada). Smaller diluted bile samples for CS (30 μL ...
-
bioRxiv - Microbiology 2023Quote: ... Amplification was accomplished in a QuantStudio 3 thermal cycler (Applied Biosystems) using the following program ...
-
bioRxiv - Neuroscience 2023Quote: ... on a QuantStudio 3 qPCR system (ThermoFisher Scientific, Waltham, MA, US).36b4 gene encoding for acidic ribosomal phosphoprotein P0 was selected as house-keeping control due to its high stability in adipose tissues (Zhang et al. ...
-
bioRxiv - Physiology 2023Quote: ... 1.2 μg of anti-RYR1 monoclonal antibody (ThermoFisher MA 3-925,) was added to the precleared extracts and incubated 1h at 4C ...