Labshake search
Citations for Thermo Fisher :
7451 - 7500 of 10000+ citations for 6 Benzothiazolamine 2 1 methylpropyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... cells were washed with PBS and incubated for 2 hours at RT with Alexa Fluor 555 donkey anti-mouse (1:1000, Life Technologies-Invitrogen). Cells were finally stained with DAPI (1:5000 in PBS ...
-
bioRxiv - Bioengineering 2021Quote: ... transfected with 1 μg plasmids at 1050v/20ms/2 pulses and cultured in a 24-well Nunc cell culture plate (Thermo Fisher Scientific) at the density of 200,000/well in PRMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Total RNA (1–2 μg) was reverse-transcribed in a 25 µl reaction using Taqman reverse transcription reagents (Applied Biosystems, CA, USA). RT-PCR multiplex reaction was performed using gene-specific Taqman primers and probes (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... 1-2 ug total RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific, #4368814). Real-time PCR was performed using specific primers for ACTN2 (GCTGAAGAAATTGTTGATGG ...
-
bioRxiv - Physiology 2019Quote: ... sections were incubated for 2 hours at room temperature with Alexa Fluor 456 conjugated donkey anti-goat secondary antibody (1:200, Invitrogen, Carlsbad, CX). After several PBS washes ...
-
bioRxiv - Immunology 2020Quote: Approximately 2 x 106 cells in 1 mL DMEM10 were seeded into wells of 12-well cell culture plate (Nunc, NY, USA). Two hours later after the cells had adhered ...
-
bioRxiv - Cell Biology 2019Quote: ... samples were then stained overnight at 4°C in 2% BSA in DPBS containing secondary antibodies and phalloidin: Goat anti-mouse-IgG1 Alexa Fluor 647 (A-21240, Invitrogen, 1:100), goat anti-mouse IgG2b Alexa Fluor 555 (A-21147 ...
-
bioRxiv - Bioengineering 2020Quote: ... 30 and 60 min after induction of neutralization of Col 1 and enzymatic gelation (n=2-5 samples/group) of freshly prepared materials with a Multiskan™ GO Microplate Spectrometer (Thermo Scientific). The following solutions were analyzed ...
-
bioRxiv - Microbiology 2019Quote: ... a 2 µL aliquot of the first strand cDNA diluted 1:50 was amplified using Phire II hot start Mastermix (ThermoFisher, Vilnius, Lithuania) and 0.12 µM of 5’-RACE primer (Table S1 ...
-
bioRxiv - Microbiology 2019Quote: ... The first PCR round was performed with 2 μL of DNA and 1 U of Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA) in a final volume of 20 μL ...
-
bioRxiv - Bioengineering 2019Quote: ... medium was switched to a B27-based Retinal differentiation medium (BRDM) (DMEM/F12 (3:1) with 2% B27 (w/o vitamin A, ThermoFisher Scientific, USA), 1x NEAA and 1x AA) ...
-
bioRxiv - Genetics 2020Quote: ... Neuronal differentiation was initiated (day 1) by the addition of Doxycycline hyclate (2 µg/mL) to N2 supplemented media (Thermo Fisher, 17502048,) in the presence of patterning factors SB431542 (Tocris ...
-
bioRxiv - Microbiology 2021Quote: ... were coated with 50 μL per well of 2 μg/mL Spike trimer or RBD in 1 x PBS (Fisher Scientific, 11510546) and incubated overnight at 4 °C ...
-
bioRxiv - Physiology 2020Quote: ... followed by a 2-hour incubation at room temperature with Alexa Fluor 488 dye-conjugated goat anti-guinea pig (1:500, Invitrogen, Oregan USA) and Alexa Fluor 555 dye-conjugated goat anti-mouse IgG1 (1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... The plasmids were transiently co-transfected into ExpiCHO cells at a ratio of 2:1 (HC:LC) using ExpiFectamine™ CHO Reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: Genome DNA was extracted from A431 cells (wild type, clones #1 and #2) using GeneArt Genomic Cleavage Detection Kit (Thermo Fisher Scientific), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 14-17 h at 4°C followed by the incubation with 100 μl of Dynabeads Protein A + G (2:1 A:G proportion, Invitrogen, 10001D and 10004D) for 2 h at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 11 cDNA fragments with 70 bp end-terminal overlaps which spanned the entire SARS-CoV-2 isolate Wuhan-Hu-1 genome (GenBank accession: NC_045512) were produced by GeneArt™ synthesis (Invitrogen™, ThermoFisher) as inserts in sequence verified ...
-
bioRxiv - Immunology 2021Quote: ... S2P6 was serially diluted 1:4 starting at 80 μg/ml in infection media (DMEM supplemented with 2% FBS and 20mM HEPES (Gibco, 15630-080)) and incubated with replication-competent VSV-SARS-CoV-2 (23 ...
-
bioRxiv - Neuroscience 2021Quote: ... The sections were then incubated for 2 h in blocking/permeabilization buffer including goat anti-rabbit AlexaFluor 568 or goat anti-mouse 488 (Invitrogen; 1:500). Sections were washed in 0.01 M PBS after primary and secondary antibody incubations ...
-
bioRxiv - Cancer Biology 2020Quote: ... along with 20 nM siRNA (unless dose is otherwise indicated) in a 1:2 ratio with Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific) for 16-24 hours at 37°C in 5% CO2.
-
bioRxiv - Developmental Biology 2020Quote: ... then incubated with species-appropriate secondary antibodies at room temperature for 2 hrs (1:1000: Alexa Fluor-488, Alexa Fluor-568, or Alexa Fluor-647; Molecular Probes®). Sections were counterstained with DAPI (1:5000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Differentiation was initiated and carried out with daily feedings of the following medium and growth factors: Day 1-2-RPMI/B27minus insulin (Cat #: A18956-01 Invitrogen, Carlsbad, CA), 100ng/mL Activin A (Cat # ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected with cDNAs encoding ER-eMagA (bait) and eMagB-TagRFP-T (prey) at a 2:1 ratio in OptiMEM-I (Thermo Fisher Scientific) (1:4 DNA ...
-
bioRxiv - Cell Biology 2020Quote: ... organoids (after 1 week of culture) were incubated (37°C, 5% CO2, 1 h) with 10 µM EdU (5-ethynyl-2’-deoxyuridine, Thermo Fisher Scientific), a nucleoside analog of thymidine incorporated into DNA during active DNA synthesis ...
-
bioRxiv - Genetics 2021Quote: ... 1 µg of intact RNA (with a 28S:18S rRNA ratio = 2:1) was reverse transcribed with the RevertAid H Minus Reverse Transcriptase kit (Thermo Scientific, EP0451). Real-time PCR reactions were performed with the Brilliant II SYBR® Green QPCR Master Mix (Agilent ...
-
bioRxiv - Immunology 2021Quote: ... in a 1:1 bead to T cell ratio and cultured in 2 ml (24-well plate) or 1 ml (48-well plate) RPMI 1640 (Thermo Fisher, 21875) supplemented with 10% Fetal Bovine Serum (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... sections were then incubated for 2 hours in the following secondaries: goat anti-rabbit IgG Alexa Fluor 568 (A11011, Invitrogen, 1:500), Cy5 streptavidin (SA1011 ...
-
bioRxiv - Microbiology 2020Quote: Expression plasmids encoding the heavy and light chains of the COVA1-16 Fab were transiently co-transfected into ExpiCHO cells at a ratio of 2:1 (HC:LC) using ExpiFectamine™ CHO Reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... was generated using 1-2 μg of RNA as a template for the SuperScript IV Reverse Transcriptase (RT) VILO master mix (Invitrogen, Thermo Fisher Scientific) with a no-RT control reaction in a half-reaction volume following manufacturer protocols ...
-
bioRxiv - Microbiology 2020Quote: ... were performed on an Ultimate 3000 RSLC nano instrument coupled to either a QExactive Plus (M#1, M#3) or an HF mass spectrometer (M#2; Thermo Fisher Scientific) as described previously.24 Tryptic peptides were trapped for 4 min on an Acclaim Pep Map 100 column (2 cm × 75 μm ...
-
bioRxiv - Microbiology 2021Quote: ... Permeabilized cells were probed with a monoclonal antibody against the HA-tag epitope (1:1000; HA Tag mAb 2-2.2.14, Thermo Fisher Scientific, Planegg, Germany) to detect SARS-2-S protein ...
-
bioRxiv - Molecular Biology 2020Quote: ... normalized to 2 mg/ml and protein expression was analysed by western blotting employing anti-V5 antibody (1:3000 dilution, Invitrogen, #R960-25).
-
bioRxiv - Immunology 2020Quote: ... cells were resuspended at 5×106 cells/mL in 1 mM MgCl2/PBS and treated with 2 mM DSG cross-linker (Thermo Fisher Scientific) at room temperature for 30 min on a rotator ...
-
bioRxiv - Immunology 2020Quote: ... Staining was performed on ice for 25 minutes in PBS with 2 % FCS using the following antibodies: 7- AAD 1:400 (Thermo Fisher Scientific), CD19-BV786 1:20 (clone SJ25C1 ...
-
bioRxiv - Neuroscience 2021Quote: ... The specimens were blocked and permeabilized using permeabilization buffer for 2 h and incubated with rabbit polyclonal antibody anti-eNOS (1:200; PA1-037; Thermo Fisher Scientific) and goat polyclonal antibody anti–collagen IV (1:100 ...
-
bioRxiv - Cell Biology 2021Quote: ... for 2 h to stain all genomic DNA and subsequently with donkey anti-mouse Alexa Fluor 647 (Thermo Fisher, A31571; 1:25)) for 45 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed three times with PBS and incubated for 2 h at 4°C with appropriate combinations of AlexaFluor-conjugated secondary antibodies (Invitrogen,1:2000) for 2 hours at 4C protected from light ...
-
bioRxiv - Biochemistry 2021Quote: ... Usually 5 µg of total protein or the total protein of 1 to 2 × 106 autophagosomes were subjected to 4 – 12 % NuPage Bis-Tris gels (Thermo Scientific, MP0335) and transferred onto a nitrocellulose membrane using the Trans-Blot Turbo RTA mini nitrocellulose transfer kit (BioRad ...
-
bioRxiv - Biophysics 2022Quote: ... Transfections were performed with 2 × 105 cells using 1 µg of plasmid by electroporation using a Neon electroporation kit (Thermo Fisher Scientific). Prior to imaging ...
-
bioRxiv - Microbiology 2022Quote: ... was generated using 1-2 μg of RNA as a template for the SuperScript IV Reverse Transcriptase (RT) VILO master mix (Invitrogen, Thermo Fisher Scientific) with a no-RT control reaction in a half-reaction volume following manufacturer protocols ...
-
bioRxiv - Cancer Biology 2022Quote: MIEV and PKCα-KR cells (≥1 × 106/condition) were labelled with CellTrace Violet (CTV; 2 μM) using CellTrace™ Cell Proliferation Kits (Life Technologies) as described previously [14] ...
-
bioRxiv - Biochemistry 2022Quote: ... Pellets from six-well plates were resuspended in 50 μl of 1× DNase buffer and incubated with 2 units of DNase (TURBO; Thermo Fisher Scientific) at 37 °C for 1 h ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR reaction mixture was loaded on 1% agarose gel (140 V for 2 h) and post-stained with SYBR gold (Thermo Fisher Scientific). The product bend was cut and DNA was extracted from the gel by Monarch DNA Gel extraction Kit (NEB) ...
-
bioRxiv - Bioengineering 2022Quote: ... is purchased from MakingCosmetics Inc. (USA). 4- (2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, 1M solution, Cat. No. J16924-AP) is purchased from Thermo Scientific (USA). Silica beads (Cat ...
-
bioRxiv - Bioengineering 2022Quote: ... Cultures were washed three times with washing solution and then incubated for 30 min at room temperature on the OrganoFlow (7°, 2-min intervals) with Alexa Fluor 488 (#a32731; Invitrogen; 1:250) and Alexa Fluor 647 (#a31571 ...
-
bioRxiv - Cell Biology 2022Quote: ... Myogenic differentiation was initiated by switching to low serum Differentiation Medium (DM: DMEM supplemented with 2% horse serum and 1% Antibiotic-Antimycotic, all Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2022Quote: ... cells were permeabilized as described above and sequentially stained with primary rabbit α-GFP antibodies (1:250; MBL) and secondary goat α-rabbit Alexa Fluor 488 antibodies (2 µg/ml; Invitrogen) for 1h at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... The plasmids were transiently co-transfected into ExpiCHO cells at a ratio of 2:1 (HC:LC) using ExpiFectamine™ CHO Reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μl of this dilution was mixed with 10 μl of a 1:100 dilution of the ERCC spike-in mix 2 (Thermo Fisher Scientific) and subjected to library preparation for next-generation sequencing (Vertis Biotechnologie ...