Labshake search
Citations for Thermo Fisher :
7301 - 7350 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... boiled for 5 min at 95 °C and loaded on 8-16% Tris-Glycine gels (Invitrogen, EC60485BOX). Proteins were transferred onto 0.2 μm nitrocellulose membranes (Bio-Rad ...
-
bioRxiv - Neuroscience 2024Quote: ... A guide RNA targeting exon 41 of the LRRK2 gene (5’-CTCAGTACTGCTGTAGAATG-3’) was commercially synthesized (ThermoFisher) and used to form ribonucleoprotein (RNP ...
-
bioRxiv - Cell Biology 2024Quote: ... and detection was performed with a QuantStudio 5 Real- Time PCR system instrument (Thermo Scientific, Waltham, MA). GAPDH was used as an internal control for all genes ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were cultured at 37ᵒC in 5% CO2 in RPMI Medium 1640 (Life Technologies, Grand Island, NY) supplemented with 10% heat-inactivated FBS (Life Technologies) ...
-
bioRxiv - Biophysics 2024Quote: ... 300±5 mOsmol) that contained 1.25 mg/ml of Texas red-dextran (Molecular Probes, Eugene, OR, USA), for 6 hours or 24 hours before being fixed as described below.
-
bioRxiv - Biophysics 2024Quote: ... and suspended in 5 µM Cell Tracker Red CMPTX dye (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), then incubated at 37°C for 60 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... Cultures were maintained at 37°C and 5% CO2 in a Hera Cell 150 incubator (ThermoFisher, USA) with agitation of 130 rpm provided by Celltron (Infors HT ...
-
bioRxiv - Cancer Biology 2024Quote: ... The amplified cDNA library was quantified using the QuantStudio™ 5 Real-Time PCR System (Thermo Fisher) through qPCR ...
-
bioRxiv - Cancer Biology 2024Quote: DNA purification: Proteins in the samples were removed by adding 5 µg of proteinase K (ThermoFisher, # AM2548) and shaking at 60°C for 2 hours ...
-
bioRxiv - Biochemistry 2024Quote: ... MDA-MB-436 cells were maintained at 37°C and 5% CO2 in RPMI 1640 (Gibco:11875085) supplemented with Penicillin/Streptomycin (100U/mL each) ...
-
bioRxiv - Neuroscience 2024Quote: Primary neurons were transfected at 5 days in vitro (DIV) using Lipofectamine 2000 Transfection Reagent (Invitrogen, 11668027) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Peptides were trapped with a PepMap100 C18 5 μm 0.3X5 mm nano trap column (Thermo Fisher Scientific) and an Aurora Ultimate TS 75μmx25cmx1.7μm C18 column (IonOpticks ...
-
bioRxiv - Immunology 2024Quote: ... staining (0.2 µg/ml for 5 minutes) and sections were mounted using Prolong Gold antifade mountant (Thermofisher). Images were collected on a Zeiss Axioimager.D2 upright microscope using 10x ...
-
bioRxiv - Microbiology 2024Quote: ... the pellet was dried for 5 to 15 minutes at 46°C (Isotemp Hybridization Incubator; Fisher Scientific) to remove residual ethanol ...
-
bioRxiv - Immunology 2024Quote: ... Step one: wells were blocked for 1 hour in 80uL of 5% Blocker BLOTTO (ThermoFisher Scientific, #37530). Step two ...
-
bioRxiv - Immunology 2024Quote: ... 6-well culture plates) for 8 days at 37°C and 5% CO2 in RPMI1640 (Life technologies) supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2024Quote: ... RNAs were labeled at 5⍰.-end using [γ32-P]ATP (Amersham Biosciences) and T4 polynucleotide kinase (Invitrogen). Labeled and unlabeled RNAs were purified on a 5% acrylamide urea gel ...
-
bioRxiv - Molecular Biology 2024Quote: ... qRT-PCR was conducted as done on a Quant Studio 5 instrument (Applied Biosystems, Carlsbad, CA, USA). 35–41 The housekeeping gene GAPDH was utilized for normalization using the ΔΔCt method ...
-
bioRxiv - Neuroscience 2024Quote: ... mixed retinal cultures were loaded with 5 µM Fura-2 AM (acetoxymethyl ester, #F1221; Thermo Fisher Scientific) with 0.01% pluronic F-127 (#P3000MP ...
-
bioRxiv - Neuroscience 2024Quote: ... cultured MPs were infected a mix of lentivirus and protamine sulfate (5 µg/mL, Thermo Fisher Scientific) to enhance lentiviral integration into the cells ...
-
bioRxiv - Neuroscience 2024Quote: ... Cultures were incubated at 37°C and 5% CO2 in Neurobasal Medium Plus (Gibco, ThermoFisher Scientific, #A3582901) supplemented with 1x B-27 (Gibco ...
-
bioRxiv - Biochemistry 2024Quote: ... we labelled MACS-purified naïve CD4+ T cells with 5 μM CellTrace Violet (C34557; Invitrogen Molecular Probes) and then cultured the cells for 72 h in complete RPMI medium (RPMI medium supplemented with 10% FBS ...
-
bioRxiv - Biochemistry 2024Quote: ... we labelled MACS-purified naïve CD4+ T cells with 5 μM CellTrace Violet (C34557; Invitrogen Molecular Probes) and then cultured the cells for 72 h in complete RPMI medium (RPMI medium supplemented with 10% FBS ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM MgCl2 and 1:1000 DNAse I (2500 U/ml, Thermo Fisher Scientific, Waltham, MA, USA) and incubated with head-over-head rotation for 30 minutes at 4 °C ...
-
bioRxiv - Genetics 2024Quote: ... female origin) and derivatives were maintained at 37°C and 5% CO2 in DMEM/F-12 (Gibco), 10% fetal bovine serum (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Phoenix-Eco cells were cultured at 37℃ in 5% CO2 with standard culture medium [90% DMEM (Gibco), 10% Fetal Bovine Serum (Corning) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and then blocked for 1 hr at room temperature in 5% Normal Goat Serum (Fisher Scientific 10098792), 10mg/mL Bovine Serum Albumin (A2153 ...
-
bioRxiv - Plant Biology 2024Quote: ... 10 min) the BN-PAGE samples were prepared using NativePAGE™ 5% G-250 sample additive (Invitrogen) at a final concentration of 0.25% ...
-
bioRxiv - Cell Biology 2024Quote: ... Peptides were extracted by incubating with 100% ACN followed by 50% ACN/5% formic acid (Thermo Fisher) for 15 mins each at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... all cells were stained for 5 minutes on ice with DAPI in PBS (1:1000, ThermoFisher, Switzerland). Epithelial and mesenchymal cells labeled with PE-Cy5 and eGFP were sorted separately and subsequently mixed in a 1:1 ratio ...
-
Autophagy suppression in DNA damaged cells occurs through a newly identified p53-proteasome-LC3 axisbioRxiv - Cell Biology 2024Quote: ... 20 μL (approximately 5% of total volume of immunoprecipitation) of pre-washed Protein A magnetic Dynabeads (Invitrogen) were added to each lysate sample ...
-
bioRxiv - Cell Biology 2024Quote: MCF10A cells were cultured in DMEM/F12 supplemented with 5% (v/v) horse serum (Thermo Fisher Scientific), 20 ng/ml EGF (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were rinsed 3X for 5 min each in PHEM before labeling with Alexa 647plus phalloidin (Invitrogen).
-
bioRxiv - Synthetic Biology 2024Quote: ... The thermal cycling and data collection were performed on Quantstudio 5 Real-Time PCR instrument (Thermo Fisher), using the thermal cycling protocol 2 min at 50 °C ...
-
bioRxiv - Microbiology 2024Quote: ... The supernatant was then desalted using a NAP-5 column (Thermo Fisher Scientific, Cat# 45-000-151) and lyophilized with a Labconco Freezone12 ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by batch labeling in SmartBatch+ with and 5 μg anti-Rabbit pS6 (Invitrogen Cat# 44-923G) per brain ...
-
bioRxiv - Neuroscience 2024Quote: ... Cultures were incubated at 37°C and 5% CO2 in Neurobasal Medium Plus (Gibco, ThermoFisher Scientific, #A3582901) supplemented with 1x B-27 (Gibco ...
-
bioRxiv - Developmental Biology 2024Quote: Dams were injected IP with 30 mg/kg body weight of 5-ethynyl-2’-deoxyuridine (EdU; Invitrogen) 12 hours prior to harvesting at E18.5 ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA was mixed with master mix containing 5 μL of Fast SYBR Green Master Mix (Applied Biosystems) and 200 nM of each primer ...
-
bioRxiv - Plant Biology 2019Quote: ... the full-length GAD2 was also amplified using primer set GAD2_forward2 (5’-CACCATGGTTTTGACAAAAACCGC-3’) and GAD2_reverse and cloned into pENTR/D-TOPO vector via directional cloning (Invitrogen), followed by a LR reaction recombinant into pMDC3240 ...
-
bioRxiv - Plant Biology 2021Quote: ... Then 500 μl of the supernatant was filtered through a gel column (NAP 5 Sephadex®, Thermo Fisher Scientific Inc. ...
-
bioRxiv - Biophysics 2021Quote: ... in the presence of 1/5 biotin-16-dUTP (JenaBioscience, NU-803-BIO16-L) to dTTP (ThermoFisher, 10520651). The PCR was done with primer CD21 (GACCGAGATAGGGTTGAGTG ...
-
bioRxiv - Cancer Biology 2021Quote: ... the cells were placed in FluoBriteTM DMEM and stained with 5 μM MitoSOXTM Red (MitoSOX, Thermo Fisher Scientific), 1 μM OxiOrangeTM or 1 μM HydropTM (Goryo Chemicals ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5% goat serum in PBS for 1 hour at room temperature or blocked with Starting Block (ThermoFisher) with 0.3% TritonX-100 for 1 hour at room temperature and then incubated overnight at 4°C with the primary antibodies rabbit anti-Iba-1 (Wako ...
-
bioRxiv - Cancer Biology 2021Quote: ... washed twice in PBS followed by the addition of 5 μl of Histogel (Thermo Scientific #HG-40000-012) and transfer to a cassette ...
-
bioRxiv - Cell Biology 2021Quote: ... and then the annealed oligos were ligated using T4 DNA Ligase (5 U/µL) (Thermo Fisher Scientific #EL0011) to either pLKO.1 puro (Addgene Plasmid #8453 ...
-
bioRxiv - Immunology 2021Quote: ... female) cells were cultured in a humidified 37°C incubator (5% CO2) in Dulbecco’s Modified Eagle Medium (Gibco) supplemented with 10% Fetal Bovine Serum and 1% Penicillin/Streptomycin ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 μL of Applied Biosystems Fast SYBR Green PCR Master Mix (Thermo Fisher Scientific, Catalog No. 4309155). Real-time PCR amplification was performed using the following program ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections of 5 µm thickness were collected on Superfrost™ Plus slides (12-550-15; Thermo Fisher Scientific). Slides were stained with Hematoxylin (nuclei ...
-
bioRxiv - Cell Biology 2020Quote: ... antibody was incubated in 5 molar excess of NHS-Alexa Fluor 546 (A20002; Thermo Fisher Scientific, Massachusetts, USA) for 3 h at RT ...