Labshake search
Citations for Thermo Fisher :
6701 - 6750 of 10000+ citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Cell lysates were incubated overnight at 4°C with the corresponding antibody bound to protein A/G-magnetic beads (Dynabeads, Invitrogen). Immuno-complexes were washed 4 times with IP and twice time with kinase buffer (25 mM Hepes pH 7.4 ...
-
bioRxiv - Cell Biology 2023Quote: ... Antibody–protein complexes were recovered during 2 h incubation at 4°C with protein A/G magnetic beads (Thermo Scientific), followed by duplicate washes of 15 min with low-salt wash buffer (0.1% SDS ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 μg of the DNA plasmids and 4 μl of Lipofectamine 2000 were mixed in 500 μl Opti-MEM I (Invitrogen) and applied to RPE1 cell in 2 ml DMEM supplemented with 10% FBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... samples were centrifuged at 15,000xg for 15 min at 4°C and the supernatant was pre-cleared with protein G-magnetic Dynabeads (#10004D, Invitrogen) at 4°C for 2h ...
-
bioRxiv - Cancer Biology 2024Quote: ... The HEK293A and HEK293T cells are culture with high glucose Dulbecco’s Modified Eagle’s Medium that contains 4.5 g/L glucose and 4 mM L-glutamine (DMEM, Gibco, Cat. No. 11965092) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Immunology 2024Quote: ... filtered through a 0.45 µm pore-sized filter to remove cell debris and concentrated by centrifugation at 100000 g for 2 h at 4°C (Thermofisher WX Ultra80 centrifuge ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.5% SDS) and incubated for 12-16 h at 4°C with 25 μL protein G Dynabeads (Invitrogen, 10004D) and 5 μg of antibody (Supplementary table 6) ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was isolated by centrifugation at 18,500 x g for 30’ at 4° C and purified by Ni-NTA affinity chromatography (Thermo Fisher) on a gravity column in the cold room ...
-
bioRxiv - Developmental Biology 2024Quote: ... the samples were incubated for 16 hours at 4°C with HA Tag-precoated Dynabeads-Protein G (Invitrogen, Cat.#: 10007D). Then the Dynabeads were rinsed with a high salt buffer (50mM Tris pH 7.4 ...
-
Efficient Suppression of Endogenous CFTR Nonsense Mutations Using Anticodon Engineered Transfer RNAsbioRxiv - Molecular Biology 2021Quote: ... one-step reverse transcriptase and quantitative PCR (RT-qPCR) was performed on the QuantStudio 3 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) using the Luna Universal One-Step RT-qPCR Kit (New England BioLabs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5’ TCTCGCTGGGGACTCTGGTTGAAAT 3’) primers (Eurofins, Louisville, KY) and SuperScript™ III One-Step RT-PCR kit with Platinum™ Taq DNA Polymerase (Invitrogen, Carlsbad, CA) using the following thermocycler conditions ...
-
bioRxiv - Genomics 2020Quote: ... A subsample of approximately 25 larvae was collected from each replicate jar on days 4 and 8 and stored in RNAlater (Thermo Fisher Scientific) for gene expression profiling.
-
bioRxiv - Immunology 2019Quote: ... 11-7139-42 or 85BRD, cat.: 11-7136-42), IL-4-PE (8D4-8, cat.: 12-7049-42) (all from Thermo Fisher Scientific); TNFa-Pacific Blue (MAb11 ...
-
bioRxiv - Cancer Biology 2020Quote: ... A431RON (Figure 3A-B and 4) or A431RON-K1114M (Figure S3B) cells were seeded in 8-well chamber slides (Nunc Lab-Tek) at a density of 30,000/well and allowed to adhere overnight ...
-
bioRxiv - Neuroscience 2019Quote: ... the pH was adjusted to 7.4 using 1 M Tris pH 8 and then dialyzed overnight at 4°C in Hartmann’s using a 10 kDa dialysis membrane (Fisher Scientific, Loughborough, UK). The concentration of IgG present after dialysis was determined using a modified Lowry assay (DC protein assay ...
-
bioRxiv - Immunology 2021Quote: ... Each well contained 2-4 μg protein in buffer (25mM TRIS pH 8, 150 mM NaCl) and 5x Sypro Orange (Invitrogen, stock 5000x) in a total volume of 20 μl ...
-
bioRxiv - Microbiology 2022Quote: ... HeLa cells and cortical neurons were cultured on Nunc Lab-Tek II 4 or 8-well glass chamber slides (Thermo Fisher Scientific). After exposure to autophagy inducing conditions ...
-
bioRxiv - Genetics 2024Quote: ... gel at 75 V for 8 h at 4°C after which gels were stained for 24 h with SYBR GOLD (Invitrogen cat. S11494) diluted 1:10000 in 1X Tris-glycine (Bio-Rad cat no ...
-
bioRxiv - Biochemistry 2023Quote: ... and centrifuged at 14500xg for 12 minutes at 4°C in a Fiberlite F21-8 x 50y Fixed-Angle Rotor (Thermo Fisher, USA). The synaptosome-rich interface between 10% and 23% Percoll layers was collected and resuspended in 30 volumes of HB ...
-
bioRxiv - Bioengineering 2023Quote: CHO-suspension cells were plated at a concentration of 7.5x10^4 cells/mL in Freestyle CHO Expression medium supplemented with 8 mM L-glutamine (Thermo Fisher Scientific, MA) in 125-mL disposable polycarbonate Erlenmeyer flasks with vented caps (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples containing 25 µg of protein were resolved on 8-16% Tris-Glycine or 4-12% Bis-Tris gels (Thermo Fisher Scientific) at 150V for 45 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were run on NuPage™ Novex™ 4-12% Bis-Tris protein gels in MES buffer or on E-PAGE 8% 48-well gels (ThermoFisher). For native running conditions ...
-
bioRxiv - Biochemistry 2024Quote: ... Reaction products were separated on 0.7% agarose gel in TA buffer (40 mM Tris-acetate pH 8) at 4 °C and visualized by Sybr Gold staining (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2024Quote: ... 20 ng/mL Interleukin-6 (IL-6) (Thermo Fisher Scientific), 20 ng/mL Interleukin-3 (IL-3 ...
-
bioRxiv - Neuroscience 2021Quote: ... 3-3.5 µg prestin plasmids and 0.4 µg eGFP plasmid were transfected to HEK 293 cells using 10 µl of Lipofectamine ® 3000 (reagent 2:1 ratio; ThermoFisher Scientific) in 500-ml Opti-MEM (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... cells were stained with 3 μg/ml Fc-Dectin-1 (a gift from G. Brown, University of Aberdeen) and 50 μg/ml TRITC-conjugated wheat germ agglutinin (Molecular Probes, Life Technologies).
-
bioRxiv - Microbiology 2020Quote: ... Insoluble material was removed by centrifugation (25,000 × g for 30 min at 20°C) prior to incubation in 1 ml of Ni-NTA agarose (ThermoFisher Scientific, #R901-01) for 2 hours ...
-
bioRxiv - Immunology 2022Quote: Plasma was pooled and heat inactivated at 56°C for 1 hour then diluted in protein G binding buffer (Pierce ThermoFisher, catalog #54200) and passed over a column containing 1mL of protein A/G resin (Pierce ThermoFisher ...
-
bioRxiv - Neuroscience 2019Quote: ... Injectable Avertin was prepared by mixing 0.5 mL stock solution (10 g 2,2,2-tribromoethanol in 6.25 mL tert-amyl alcohol; Sigma-Aldrich, T48402-25G, and Fisher Scientific, A730-1, respectively) with 39.5 mL 0.9% normal saline ...
-
bioRxiv - Microbiology 2021Quote: ... Triplicate ABC07/ABC10 libraries prepared by METa assembly or blunt ligation were plated on MH+KA50 supplemented with 1,000 μg/ml (1 mg/ml) penicillin G sodium salt (Fisher Scientific, cat#AAJ6303214). The 162 Gb soil library was plated on MH+KA50 supplemented with 64 μg/ml nourseothricin sulfate (Dot Scientific ...
-
bioRxiv - Immunology 2022Quote: ... Samples for DNA extraction were processed by addition of DNA Backextraction buffer (9.09 g Tris base (Fisher Scientific, Cat# 77-86-1) was added to a 3.75 mL 1M sodium citrate (Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... first on solid YE4S agar and then in liquid Edinburgh Minimal Media supplemented with 20.0 g/L Dextrose Anhydrous (Fisher Scientific BP350-1) and 5.0 g/L Ammonium Chloride (Sigma A9434 ...
-
bioRxiv - Physiology 2022Quote: ... C2C12 cells were differentiated into myotubes with low-glucose DMEM (1 g/L glucose with 4mM L-glutamine and 110 mg/L sodium pyruvate; Gibco 11885-084) supplemented with 2% horse serum (defined ...
-
bioRxiv - Physiology 2019Quote: ... C2C12 cells were differentiated into myotubes with low glucose DMEM (1 g/L glucose, [+]L-Glutamine, [+]110 mg/L sodium pyruvate; Gibco 11885-084) supplemented with 2% horse serum (Defined ...
-
bioRxiv - Cell Biology 2019Quote: ... First-strand cDNA was synthesized from 1⎧g purified total RNA with SuperScript™ III First-Strand Synthesis system (Thermo Fisher Scientific). For RT-PCR ...
-
bioRxiv - Physiology 2020Quote: ... Sections were then incubated with Alexa Fluor® 488 conjugated goat anti-rat immunoglobulin G (IgG; [H+L]; 1:100, Life Technologies) for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... To induce differentiation the cells were seeded into 24-well plates at a density of 2.5 x 104 cells/well and then shifted to DMEM with low glucose (1 g/L; Gibco, Life Technologies, cat. # 11885076) with the same FCS concentration and supplements used for BM-derived SSC differentiation.
-
bioRxiv - Systems Biology 2022Quote: ... Transfection reagent and media were removed from LX293T cells approximately 16 hours later and transfected cells were re-fed with 1 g/L glucose DMEM (Life Technologies 11885076), 1% Antibiotic-Antimycotic (Thermo 15240062) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were purified on a 1% agarose gel and extracted using the GeneJET G el Extraction Kit (Thermo Fisher Scientific, Germany). The competent E ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cell extracts were incubated with 12 μg anti-PRG-1 antibody (15) and 60 μl Protein A/G dynabeads (Thermo Fisher Scientific) at 4°C for 3 h ...
-
bioRxiv - Molecular Biology 2024Quote: Primary dermal fibroblasts were from a forearm skin punch biopsy from the proband and cultured in Dulbecco’s Minimal Essential Media (DMEM) containing 4.5 g/L glucose supplemented with 10% heat inactivated fetal bovine serum and 1% antibiotic-antimycotic (Life Technologies, Carlsbad, CA). Control cells obtained from Coriell Institute (Camden ...
-
bioRxiv - Neuroscience 2023Quote: ... Immunocomplexes were isolated with protein A/G beads (Thermo, 20421) and eluted 1× LDS sample buffer with 10% β-mercaptoethanol (Invitrogen; NP0007) at 55 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... slides were washed in PBS and incubated with goat anti-rabbit immunoglobulin G (IgG) (H + L) secondary antibody conjugated with Alexa Fluor 594 (Invitrogen, 1:200). Slides from eWAT were incubated with anti-F4/80 (ab300421 ...
-
bioRxiv - Biochemistry 2023Quote: ... were solubilised in 2 % MeCN with 0.1 % TFA to 0.2 μg/μL concentration before being injected in volumes equivalent to 1 μg on an UltiMate 3000 RSLC nano System (Thermo Fisher Scientific). Peptides were trapped for 5 min in A (0.1 % FA in water ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by an incubation of 100 μl of a 2:1 (A:G) mixture of Dynabeads Protein A and G (Invitrogen, 10001D and 10004D) for 2h at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The bottom of the column was opened to collect the flow-through by centrifugation at 1,000 x g for 1 min (Heraeus Multifuge X 1R centrifuge, Thermo Scientific, Osterode, Germany). This instrument was used for all centrifugation steps ...
-
bioRxiv - Immunology 2024Quote: ... the microtiter plates were washed 5 × with T-PBS and then incubated for 1 hour at room temperature with 2 μg/ml of biotinylated recombinant protein G (PierceTM, Thermo Fisher Scientific) for recognition of IgG antibodies from human ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA extracts (2 μg) were treated with DNase I (1 U/µl, Fermentas, USA) in the presence of DNase I buffer 10 × (Thermo Fisher Scientific,) with MgCl2 for 30 min at 37 °C ...
-
bioRxiv - Systems Biology 2024Quote: ... About 2 µg per fraction in 1% formic acid was analyzed in 90 min by LC-MS on an Orbitrap Ascend (Thermo Fisher Scientific) using a Real-Time-Search MS3 method25 ...
-
bioRxiv - Bioengineering 2024Quote: ... supernatant collected after centrifuging at 100,000⋅g for 18 hours) and 1% Antibiotic- Antimycotic (100X) (Thermo Fisher Scientific, Cat. # 15-240-062). Cells were added at 5,000 cells/cm2 to 150 mm Petri dishes and media supplemented with a final concentration of 50 µM ascorbic acid 2-phosphate (Sigma Aldrich ...