Labshake search
Citations for Thermo Fisher :
6651 - 6700 of 6840 citations for H D Glu amc oh since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... first the promotor region of tret1-1 was cloned from genomic DNA (forward primer: CACCGGTCTCAAGCTCTCTTTTTTGCCTTACATATTTT, reverse primer: TGGGTAAGTTGGAGAGAGAG) into the pENTR™ vector using the pENTR™/D-TOPO® Cloning Kit (Thermofisher). Via the gateway system ...
-
bioRxiv - Microbiology 2020Quote: ... Cloning of the pET151-YtgCR-3xFLAG vectors was performed following manufacturer protocols for TOPO directional cloning into the pET151-D/TOPO base vector (Invitrogen, Thermo Fisher Scientific). The YtgCR sequence was amplified from C ...
-
bioRxiv - Molecular Biology 2020Quote: ... HUVECs were successively stained with goat anti syndecan-4 (Cat No: AF2918-SP, R&D Company, USA) and rabbit anti-goat IgG secondary antibody (Cat No: A27018, Thermo Fisher Scientific, USA). Then the syndecan-4 expression on HUVECs was measured by flow cytometry with a BD Biosciences LSR II (BD Biosciences ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNAs from 7-d-old seedlings grown on 1/2 MS with or without 1 μM ABA were extracted using TRIzol (Invitrogen, Carlsbad, CA, USA) or Universal Plant Total RNA Extraction Kits (Spin-column)-I (BioTeke ...
-
bioRxiv - Microbiology 2021Quote: ACPL-GFP D10 and NF54 PfMev parasites were synchronized with 5% (w/v) D-sorbitol for 10 minutes at room temperature and returned to culture in 10 µM fosmidomycin (Invitrogen Life Technologies F23103), 100 nM atovaquone (Caymen Chemicals 23802) ...
-
bioRxiv - Neuroscience 2020Quote: ... to identify fluorescent particles on confocal stacks using Drosophila brains stained with the lipid droplet dye BODIPY 493/503 (Molecular Probes, D-3922) or labelled with the glial specific marker Repo (immunlocalization of glial nuclei) ...
-
bioRxiv - Plant Biology 2020Quote: ... or pDONR221-P1P4 (first acceptor) or pENTR™/D-TOPO® (second acceptor) as described by guidelines in the Gateway manual (Life Technologies) with primers listed in SI Table 3 ...
-
bioRxiv - Microbiology 2020Quote: ... 10 ml l1 glycerol and 20 g l−1 Bacto agar) supplemented with 25 µg ml−1 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal, Thermo Fisher Scientific). Overnight cultures of the control strains were normalized to OD600 = 1.0 and inoculated as 20 µl spots on the agar plates containing the biosensor ...
-
bioRxiv - Systems Biology 2020Quote: ... 100 mM D-luciferin was prepared in sterile 0.1 M sodium phosphate buffer (PB) and mixed on an Eppendorf ThermoMixer (Thermo Fisher Scientific, Waltham, MA) at 37° C for two minutes @ 1500 RPM ...
-
bioRxiv - Molecular Biology 2021Quote: ... oligonucleotides from homologous regions D-ORF5 5′CCGctgagCAAGGTAGCCTCGTCTATTGGAC 3′ and R-ORF7 5′CCGctcgagTTCTTCATCTTCAATATTATGTC3′ were used using the PCR Reagent System Kit (Invitrogen, Life Technologies Inc.). The reaction mixture was prepared with l00 ng of recombinant TnGV DNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... 500 µL of Herpes solution and 2.5 mL of 100 mM CaCl2), staining with Annexin V PE (BD Pharmagen™, BD Biosciences, CA, US and 1 mM 7-Aminoactiomycin D (Thermo Fisher Scientific) and analysis by Flow Cytometry using a BD LSRFortessa X20.
-
bioRxiv - Cell Biology 2021Quote: ... Dharmacon L-006009-00-0010) or control non-targeting siRNA (25 or 50 nM; Dharmacon; Cat. No. D-001810-10-20) using Oligofectamine (Invitrogen, Cat. No. 12252011) as we described56.
-
bioRxiv - Neuroscience 2022Quote: ... Mouse hippocampal neurons were plated on 18 mm coverslips that were coated in poly-D-lysine and mouse laminin (Thermo Fisher Scientific, 23017015) for 2 hours at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were washed in PBSE-d and labeled with a goat anti-rabbit APC conjugated secondary antibody (1:500 dilution, ThermoFisher Scientific, cat # 31984) and DAPI (1:5000 dilution ...
-
bioRxiv - Cancer Biology 2020Quote: ... mice were first injected intraperitoneally with 200μL of 30% D-luciferin (Xenogen, Hopkinton, MA, USA) in PBS with calcium and magnesium (Life Technologies, Mulgrave, Vic, Australia) and imaged under anesthesia using the IVIS Imaging System 200 Biophotonic Imager (Xenogen ...
-
bioRxiv - Microbiology 2020Quote: ... or the same amount of control IgG (R&D, Cat. AB-105-C) together with 40 μl of Dynabeads Protein G (Thermo Scientific, Cat. 10003D) at 4 °C overnight ...
-
bioRxiv - Plant Biology 2021Quote: ... A 0.5 g sample of the collected tissues were ground under liquid nitrogen and suspended in 1 ml of co-IP extraction buffer (1× PBS, 1% n-dodecyl-β-d-maltoside (Invitrogen, Carlsbad, CA), protease inhibitor cocktail cOmplete™ (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: ... sections were incubated in primary antibody (chicken anti-GFP, Aves labs GFP-1010, 1/500; goat anti-PDGFRA, R&D Systems AF1062, 1/200; rat anti-SOX2, ThermoFisher 14-9811-82 ...
-
bioRxiv - Immunology 2022Quote: ... remaining tissue was digested in 30ml Collagenase solution (RPMI 1640 supplemented with 1mM MgCl2, 1mM CaCl2, 5% FBS, and 100 units/ml collagenase D (Gibco, Thermo Fisher Scientific) for 1 hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... Panc1 and MiaPaCa2 with RBFOX2 knockdown and non-targeting control were generated using human Affymetrix Clariom D Arrays (Life Technologies, Cat. no. 902922) with the standard input kit run on the Applied Biosystems GeneChip 3000 instrument ...
-
bioRxiv - Molecular Biology 2022Quote: ... As a control, siGENOME Non-Targeting Pool #1 (Dharmacon, D-001206-13-05) and a second independent predesigned PURA siRNA (Thermo Fisher Scientific, 289567) was used as described for the PURA siRNA pool ...
-
bioRxiv - Cell Biology 2020Quote: ... F5Y, and F5A-HA-GLUT4-GFP (62, 63) were subcloned into the pLenti6/V5-D™-TOPO® vector (K4955-10; Life Technologies). 293FT packaging cells were transfected with lentiviral cDNA using Lenti-X packaging system (631276 ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-HuC/D (a pan-neuronal marker to identify the cytoarchitecture and borders of the PVH; 1:500; Life Technologies, Carlsbad, CA), and either a rabbit anti-CRH (PBL#rC68 ...
-
bioRxiv - Plant Biology 2020Quote: ... The histone H3.1 gene (At5g65360) and its promoter (1167 bp upstream of the start codon) were cloned into pENTR/D-TOPO (ThermoFisher Scientific, Waltham, MA) and then sub-cloned using Gateway Technology into the plant binary vectors pB7WG (57) ...
-
bioRxiv - Microbiology 2020Quote: ... The transformed cells were plated out onto LB agar supplemented with 35 μg/ml chloramphenicol and Isopropyl β-D-1-thiogalactopyranoside/X-gal (Fisher Scientific, USA) and incubated at 37°C for 18 hours and the plasmid was extracted using the Monarch Plasmid Miniprep Kit (New England Biolabs ...
-
bioRxiv - Plant Biology 2020Quote: Arabidopsis lines were transformed with the genomic sequences of NOT4A and PGR3 plus ∼2KB of the upstream promoters cloned into Invitrogen pENTR™/D-TOPO™ (ThermoFisher-K240020) (For primer sequences see Data sheet 3 ...
-
bioRxiv - Neuroscience 2020Quote: ... for the motor-neuron plating, we treated the surface poly-D-lysine (PDL, 20 μL, 0.1 mg/mL) (A3890401, Gibco, ThermoFisher Scientific, Waltham, USA) for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: The monoclonal antibodies, anti-CD9 Alexa Fluor® 488-conjugated (R & D systems, Canada) or anti-CD63 Alexa Fluor® 488-conjugated (Invitrogen, ThermoFisher Scientific) or anti-CD81 Alexa Fluor® 488-conjugated (R & D systems ...
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...
-
bioRxiv - Microbiology 2022Quote: ... organoids were dissociated from the Cultrex Basement Membrane Extract (BME, R&D Biosystems, Bio-Techne, 3533- 001-02) using dispase (ThermoFisher Scientific, 17105-041) for 30 min at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... attachment media was removed and replaced with maintenance media (Neurobasal [Gibco] supplemented with 33mM D-glucose [Sigma], 2mM GlutaMax [Gibco], Penicilin (100units/mL) / Streptomycin (100µg/mL ...
-
bioRxiv - Plant Biology 2022Quote: The ORF of OsRZF1 gene without stop codon was amplified (Supplemental Table 1) and cloned to the entry vector with pENTR™/D-TOPO® Cloning Kit (Invitrogen, USA). Then the 2×35s promoter (Marquès-Bueno et al. ...
-
bioRxiv - Microbiology 2022Quote: ... Tissues were incubated with primary antibodies (mouse anti-HuC/D IgG clone 16A11 at 1:200 [ThermoFisher], rabbit anti-tubulin β-3 (TuJ1) polyclonal IgG at 1:500 [Biolegend] ...
-
bioRxiv - Neuroscience 2022Quote: ... neurons were incubated overnight at 37°C in a complete medium supplemented with 10 µg/ml DQ™ Red BSA (Invitrogen, D-12051) essentially as described (Sharifi et al. ...
-
bioRxiv - Physiology 2022Quote: ... Microarray experiments were conducted by the Microarray Unit at the National Institute of Genomic Medicine (INMEGEN, Mexico City) using the mouse Clariom™ D Assay (Applied Biosystems™), as per manufactureŕs instructions ...
-
bioRxiv - Zoology 2022Quote: ... Fluorescence from sperm cells preserved for 7 d and 10 d was observed and captured using an EVOS™ M7000 Imaging system with GFP and RFP light cubes (Thermo Fisher Scientific). The observation was repeated four times per sperm sample ...
-
bioRxiv - Microbiology 2024Quote: ... DDX17 (L-013450-01-0005) or non-targeting Control Pool (D-001810-10-05) using the Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific, #11668019) according to the manufacturer’s instructions in 6 well plates ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK293T cells and rat neurons were plated on 18 mm coverslips that had been coated with poly-D-lysine (Thermo Fisher Scientific, ICN10269491) for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... and mechanically dissociated by trituration before being plated onto poly-D lysine-coated coverslips and incubated in Neurobasal™ media (Gibco 21103-049) supplemented with 1 % fetal bovine serum (FBS) ...
-
bioRxiv - Cell Biology 2023Quote: We profiled the expression of transcripts in human aortic vascular smooth muscle cells using the Clariom D human DNA microarray (Thermo Fisher Scientific Inc.). This platform includes information from probe sets representing known and predicted exons and introns on both strands of the genome that have been mapped to more than genes ...
-
bioRxiv - Cancer Biology 2022Quote: ... HepG2 or MCF-7 cultures were grown for imaging on poly-D-Lysine coated 8-well LabTek II chambered coverglasses (Nunc, Rochester, NY, USA) for 1-2 days ...
-
bioRxiv - Microbiology 2023Quote: ... washed with D-PBS and further incubated with a monoclonal antibody against CD11c conjugated with PE-Cyanine7 (1:200; Thermofisher 25-0114-82) for 30 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... One hundred and thirty thousand cells per well were plated on poly-D-lysine-coated 24-well plates in Neurobasal medium (Thermo Fisher Scientific, Germany) supplemented with B-27 (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... 200 μL of the virus dilution containing 1µg-3µg p24 antigen was transferred to a poly-D-lysine coated glass coverslip (#1 chambered coverglass, Nunc™ Lab-Tek™, Cat. No. 155411, Thermo Scientific) and incubated at 37 °C for 3-5 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... BMP6 was a generous gift from OSTEOGROW. ERFE was detected using DYKDDDDK Epitope Tag HRP-conjugated Antibody (R&D, Cat. # HAM85291) and FAM132B Polyclonal Antibody (Invitrogen, Cat. #PA5-67448). Recombinant ALK3-Fc fusion protein was purchased from R&D (Cat ...
-
bioRxiv - Neuroscience 2023Quote: ... Then cells were transferred to a 15ml tube containing plating media (D-MEM supplemented with 10% Fetal bovine serum and 100 U/ml penicillin/streptomycin (Life technologies 15070-063). Cells were resuspended by mechanical agitation through fire-polished glass Pasteur pipettes of decreasing diameters ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA fragment encoding TwCel5CBM was cloned (30 - 412 amino acid residues) into the directional champion pET151/D-TOPO™ expression vector (Invitrogen, Carlsbad, CA), which adds a cleavable N-terminal V5-6xHis-tag to the protein as per manufactures instructions.
-
bioRxiv - Neuroscience 2022Quote: ... the electrode area of all HD-MEAs was treated with poly-D-lysine (PDL, 20 μL, 0.1 mg mL-1; A3890401, Gibco, ThermoFisher Scientific, Waltham, USA) for 1 hour at room temperature and then rinsed three times with sterile water ...
-
bioRxiv - Genomics 2023Quote: ... The fragmented and primed mRNA was further subjected to first-strand synthesis in the presence of Actinomycin D (Gibco, Life Technologies, CA, USA) followed by second-strand synthesis ...
-
bioRxiv - Neuroscience 2023Quote: ... The pellet was re-suspended in Schwann cell medium (DMEM with D-valine (Miclev, #AL251) supplemented with 2mM glutamine (Thermo Fisher Scientific, #23030081), 10% Fetal Bovine Serum (Sigma ...