Labshake search
Citations for Thermo Fisher :
6501 - 6550 of 10000+ citations for Human UFL1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... Lipofections were performed using 2 μg gRNA plasmid and 2 μg donor construct in OptiMEM medium (GIBCO) and Lipofectamin Stem reagent (Invitrogen ...
-
bioRxiv - Systems Biology 2019Quote: ... 10 ng pCAG hyPBase [64] plasmids were transfected using Lipofectamine 3000 (Cat# L3000015, Life Technologies, Gaithersburg, MD), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... When using Lipofectamine 2000 we prepared the transfection mixes diluting the plasmid stock in OptiMEM (ThermoFisher Scientific) to yield 500 ng/50 μl ...
-
bioRxiv - Synthetic Biology 2020Quote: ... GP64 RNA was synthesized from the prepared plasmid using MEGAscript T7 in vitro transcription kit (Thermo scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: 10ug of Zc3h10-CTAP or CTAP vector plasmid were transfected in 293FT cells using lipofectamine 2000 (Invitrogen). Cells were lysed and immunoprecipated using buffers from the InterPlay Mammalian TAP system manufacturer recommended with the noted exception ...
-
bioRxiv - Molecular Biology 2019Quote: Plasmid transfections to generate Flp-In T-REx cells were done using Lipofectamine 2000 (Thermo Fisher Scientific) following the manufacturer’s instructions and medium was changed 5 h after transfection ...
-
bioRxiv - Genomics 2019Quote: ... Table 3) and 2.5 µg of the PB-SRT-Puro plasmid using Lipofectamine 3000 (Thermo Fisher #L3000015) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... using PCR products from other plasmids or synthetized DNA fragments (GeneArt™ String™ fragments, ThermoFisher, USA). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were transfected with a selected reporter plasmid using the Lipofectamine LTX/Plus reagent (Thermo Fisher Scientific). Where required ...
-
bioRxiv - Biochemistry 2020Quote: ... quinquefasciatus salivary glands and was cloned in pET-17b plasmid and expressed in BL21 pLysS cells (Invitrogen). Protein expression was carried out as previously described51 ...
-
bioRxiv - Molecular Biology 2021Quote: ... per μg of plasmid DNA were mixed with pre-warmed Opti-MEM media (ThermoFisher Scientific, 31985-062) to a final volume of 950 μl in tube A ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 0.5 µg of mini-gene plasmid (Table S3) using lipofectamine 2000 reagent (Invitrogen–Thermo Fisher Scientific). These cells were incubated for 24 h and 4 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 0.5 µg of mini-gene plasmid (Table S3) using lipofectamine 2000 reagent (Invitrogen–Thermo Fisher Scientific). These cells were incubated for 24 h and 4 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 ug of DNA plasmid containing mNG21-10 was added to 1 ml of Opti-MEM (Gibco) in one tube and 53 ul of ExpiFectamine 293 (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... containing 200 ng/well of plasmid DNA with 3 μl per μg DNA of Lipofectamine 2000 (Invitrogen). After the 30 minute incubation Opti-MEM in the wells was replaced with 500 μl per well Opti-MEM and 100 μl per well of transfection mixes were added ...
-
bioRxiv - Microbiology 2021Quote: ... Vero cells were electroporated with 100 ng of a plasmid encoding mCherryP using a Neon system (ThermoFisher), pulsed at 220V and 950 µF ...
-
bioRxiv - Microbiology 2019Quote: ... plasmid isolation and purification of DNA fragments were performed using kits and reagents supplied by Thermo Fisher Scientific according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2019Quote: ... Plasmids were supercoiled using the protocol by Keller by reacting pUC19 with topoisomerase IB from Thermo Fisher Scientific (Toronto ...
-
bioRxiv - Cell Biology 2019Quote: ... and pMYs-IRES-Puro RNF167 WT plasmids using Lipofectamine 3000 reagent (L3000-015, Invitrogen, Carlsbad, CA, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... together with 10.5 µg of the GeCKOx/GeCKOxs library plasmids in 1ml of Opti-MEM (Life technologies). 60 µl Lipofectamine 2000 Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: Plasmids expressing GST- and His-tagged proteins were transformed into BL21(DE3) competent cells (Thermo Scientific, EC0114) and grown in LB media at 37°C ...
-
bioRxiv - Genomics 2021Quote: ... and 1.5 μg of dCas9-KRAB repression plasmid per well by Lipofectamine 3000 transfection reagent (Invitrogen; L3000015) as the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: Plasmids encoding RiboTag constructs were used to transiently transfect HEK293 cells with lipofectamine 3000 (Thermo Fisher Scientific) as recommended by the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 30μg pX330 plasmids were introduced into ∼3 × 106 PK-15 cells resuspended in 300μL Opti-MEM (Gibco) in 2 mm gap cuvettes using BTX-ECM 2001 ...
-
bioRxiv - Neuroscience 2020Quote: ... coli containing the expression plasmids were grown in complete LB broth (Thermo-Fisher Scientific, Waltham, MA, USA) at 30°C with shaking until cell cultures reached an OD 600 of approximately 0.5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Plasmid transfection and virus infection: Expression constructs were transfected into cells using Lipofectamine 2000 Transfection Reagent (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA (2-3 μg) was diluted in 400 μL Opti-MEM (11058021, Thermo Fisher Scientific, USA) spiked with 2-3 μL Plus reagent (15338100 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transiently transfected with LAMP1-GFP expressing plasmid mixed with Lipofectamine 3000 (ThermoFisher, Cat No. L3000008) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... This plasmid was transfected into cells together with the Flp-recombinase expression vector pOG44 (Thermo Fisher; V600520). After two days ...
-
bioRxiv - Cell Biology 2021Quote: ... mRNA was in vitro transcribed from linearized pCS2+ plasmids using the mMessage mMachine SP6 Transcription kit (Ambion) and purified using the RNeasy Mini kit (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: ... The splicing assay was performed by transiently transfecting HEK293T cells with each plasmid using Lipofectamine 2000 (ThermoFisher). At 48 hours post-transfection ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments for plasmid construction were amplified with Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, MA) as specified by the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Complementing plasmids were constructed by cloning the wild type gene synthesized by GeneArt Gene Synthesis (Thermo Scientific) into the multiple cloning site of pJN105 using SpeI and SacI restriction enzymes from New England Biolabs (Australia) ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid was used to transiently transfect FreeStyle 293F cells using FreeStyle MAX reagent (Thermo Fisher Scientific). The S ectodomain was purified from filtered supernatant on Streptactin XT resin (IBA Lifesciences) ...
-
bioRxiv - Microbiology 2021Quote: ... Stable transfectants carrying plasmids with BSD-selectable marker were initially selected on 2μg/mL blasticidin-S (Invitrogen). In order to obtain parasites carrying large plasmid copy numbers ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were co-transfected with two donor and a gRNA plasmid using Lipofectamine2000 (Thermo Fisher, 11668019). 24h after transfection ...
-
bioRxiv - Immunology 2021Quote: SARS-CoV-2 S protein-expressing plasmids were transfected into HEK293T cells using Lipofectamine 3000 (Invitrogen, USA). 24 h after transfection ...
-
bioRxiv - Immunology 2021Quote: ... Heavy and light chain plasmids were transfected into 96-well cultures of ExpiCHO cells (ThermoFisher Scientific, A29127) for microscale expression ...
-
bioRxiv - Immunology 2020Quote: ... HEK-293 and AD100 cells were simultaneously transfected with B45 and pcDNA 3.1 plasmid by lipofectamine (Invitrogen) following the manufacturers’ protocols ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with plasmids or siRNAs using Lipofectamine LTX Reagent with PLUS Reagent (Thermo Fisher Scientific) or RNAiMAX (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... Transfection of pBOS-KAP1-YFP plasmid into HeLa cells was performed by using lipofectamine 2000 (Invitrogen, #11668019).
-
bioRxiv - Cell Biology 2019Quote: ... A 6-well plate was transfected with 4 µg of the appropriate plasmid using Lipofectamine 2000 (ThermoFisher) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Plasmids were linearized and RNA in vitro transcribed using the mMessage mMachine™ T7 Transcription Kit (Invitrogen) and purified by LiCl precipitation according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... pT7/VP3SA11 and pT7/NSP1SA11 plasmids were modified using a Phusion site-directed mutagenesis kit (ThermoFisher Scientific) and the primers indicated in Table 1 ...
-
Bipartite viral RNA genome heterodimerization influences genome packaging and virion thermostabilitybioRxiv - Molecular Biology 2022Quote: ... Universal upstream (TGCATAATTCTCTTACTGTCATGCCATCCGTAAG) and downstream (TAAGAGAATTATGCAGTGCTGCCATAACCATG) primers were used to target the backbone of pMT plasmids (Invitrogen). Overlapped PCR fragments were generated (Phusion High-Fidelity DNA Polymerase ...
-
bioRxiv - Developmental Biology 2022Quote: ... intact MERVL sequence was obtained from a bacterial artificial chromosome (BAC) plasmid (RP23-231A8, https://www.ncbi.nlm.nih.gov/nuccore/AC127321.4, Thermo Fisher Scientific) and subcloned into pCAGGS_Myc plasmid using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) ...
-
bioRxiv - Biochemistry 2022Quote: ... and each pSBbi-Bla plasmids (EV, WT, F631A/F632A) were transfected using Lipofectamine 2000 (Thermo Fisher Scientific). Four days after transfection ...
-
bioRxiv - Microbiology 2022Quote: ... DNA from PCR-positive yeast colonies were isolated using the ChargeSwitch™ Plasmid Yeast Mini Kit (Invitrogen) and electroporated into epi300 electrocompetent cells ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were transfected with 200 ng of the reporter plasmids using Lipofectamine® 2000 Transfection Reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mitfa:mCherry was Gateway recombined using the mitfa zebrafish promoter and a mCherry middle entry plasmid (ThermoFisher #12538120). Ubi:caSMAD2 was cloned by PCR amplifying human SMAD2 pDONR221 (DNASU HsCD00045549 ...