Labshake search
Citations for Thermo Fisher :
6351 - 6400 of 10000+ citations for Hydrogen Peroxide Fluorescent Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Membranes in Figure S1A and Figure S8A (left) were incubated with fluorescent secondary antibodies (Goat anti-mouse IgG DyLight 800 ThermoFisher #SA5-10176 and Goat anti-rat IgG DyLight 800 ThermoFisher #SA5-10024) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were then washed with PBS and incubated with the appropriate fluorescent secondary antibody (all from Thermo Fisher, 1/500) for 1h at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... One fluorescent variant of aEPEC 1711-4 was obtained by transforming the wild-type strain with the recombinant plasmid pDP151 (Invitrogen), which encodes the fluorescent protein mCherry and confers resistance to ampicillin.
-
bioRxiv - Biophysics 2024Quote: ... prepolymer solutions of the 3900 kPa native placental stiffness containing 0.5% volume of 0.5 μm diameter carboxylate-modified fluorescent beads in PBS (FluoSpheres, Invitrogen, Catalog: F8812) were prepared as previously described34 ...
-
bioRxiv - Cell Biology 2024Quote: ... an existing HEK293A cell line expressing the NeonGreen21-10 split fluorescent protein (Wills et al., 2023) was suspended in electroporation buffer R (Neon Transfection system, ThermoFisher) at 40,000 cells/µl ...
-
bioRxiv - Cancer Biology 2024Quote: ... Transfected cells were selected by visible expression of red fluorescent protein (RFP) and puromycin resistance (0.5 ug/ml) (ThermoFisher Scientific) provided by the HDR plasmid ...
-
bioRxiv - Biophysics 2023Quote: ... The skewed space deconvolution was performed as described previously60 with experimentally measured point spread functions obtained from 200 nm fluorescent beads (Invitrogen FluoSpheres Carboxylate-Modified Microspheres ...
-
bioRxiv - Cell Biology 2024Quote: ... SIM images were reconstructed with ZEN software and then channel alignment was performed using 100 nm TetraSpeck fluorescent beads (Cat#T7279, Invitrogen) embedded in the same conditions as the sample.
-
bioRxiv - Neuroscience 2024Quote: We then measured the point spread function (PSF) of the light-targeting system using subdiffraction-sized fluorescent beads (TetraSpeck microspheres, radius 50 nm; T7279, Invitrogen) embedded in agarose gel (1.5 % ...
-
bioRxiv - Neuroscience 2024Quote: ... slices were stained with fluorescent secondary antibodies (Alexa Fluor 488 goat anti-rabbit secondary antibody, A-11008, Invitrogen, RRID: AB_143165) and DAPI at 1:500 dilution at 4°C for 24 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were washed three times in PBS and incubated for 1 h at RT with the appropriate secondary antibodies conjugated with fluorescent dyes (Invitrogen, Molecular probes ...
-
bioRxiv - Neuroscience 2024Quote: ... retinae were bulkelectroporated with the synthetic fluorescent calcium indicator Oregon-Green 488 BAPTA-1 (OGB-1; hexapotassium salt; Life Technologies) (94) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... were stably transfected with the fluorescent, ubiquitination-based cell cycle indicator (Fucci) (Sakaue-Sawano, et al. 2008) plasmid using Lipofectamine 3000 Transfection Reagent (Invitrogen) following the manufacturer’s specified instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... of the imaging intensity profile of 0.51 µm green fluorescent polymer microspheres (Fluoro-Max, Dia: 0.51 µm, Thermo Fisher Scientific) buried in 2% agarose gel ...
-
bioRxiv - Cell Biology 2023Quote: ... Fluorescent images of DAPI-stained clusters were collected as Z-stacks on an EVOS M7000 Imaging system (Thermo Fisher Scientific) using a 4X PlanFL 0.13 NA objective using the DAPI light cube ...
-
bioRxiv - Cell Biology 2023Quote: ... as per the manufacturer’s protocol) and a fluorescent Alexa Fluor tag (Alexa Fluor® succinimidyl esters, Invitrogen™, Molecular Probes® ...
-
bioRxiv - Biophysics 2024Quote: ... The fluorescent probe TexasRed-DHPE (1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine, triethylammonium salt) was purchased from Invitrogen (Waltham, MS, USA). Rh-DHPE (N-(Lissamine rhodamine B sulfonyl)-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5% goat serum in PBS] for 1 h at room temperature (RT) and stained using proper primary and fluorescent-dye-conjugated secondary antibodies (Alexa Fluor dyes, Invitrogen). Incubations of primary antibodies were performed overnight at 4°C and for fluorescently conjugated secondary antibodies 1h at RT ...
-
bioRxiv - Genetics 2022Quote: ... we incubated the samples in blocking solution with fluorescent dye-conjugated secondary antibodies and the nuclear counterstain DAPI (ThermoFisher Scientific) at 4 °C overnight ...
-
Cortical cerebrovascular and metabolic perturbations in the 5xFAD mouse model of Alzheimer’s diseasebioRxiv - Neuroscience 2023Quote: The vessel painting technique is based on the ability of the fluorescent dye 1,1’-dioctadecyl-3,3,3’3’-tetramethylindocarbocyanine perchlorate (DiI, Life Technologies, Carlsbad, CA, USA) to bind to lipid membranes ...
-
bioRxiv - Physiology 2023Quote: ... Worms were then incubated overnight in the dark at room temperature with 33 µM SYTO 12 Green fluorescent nucleic acid stain (ThermoFisher) in NGM and a small amount of E ...
-
bioRxiv - Microbiology 2023Quote: ... Cryosectioned lung tissue sections (5 μm/section) from infected mice were stained using polyclonal anti-Ax rabbit sera and appropriate fluorescent conjugate secondary antibody (Invitrogen). Tight junctions were stained via a polyclonal goat antibody against ZO-1 and relevant secondary antibody (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were washed with TBST and incubated with the required fluorescent-dye conjugated secondary antibody (1:1000) for 1 h at RT (Alexafluor, Invitrogen, Thermofisher). Slides were mounted with DAPI Pro-LongDiamond antifade mountant overnight and analyzed the next day ...
-
bioRxiv - Neuroscience 2023Quote: A Neuropixels probe phase 3A (imec, Belgium (Jun et al. 2017)) coated with a fluorescent dye (DiD, DiI or DIO, Thermofisher) was lowered slowly into the right SC and dPAG ...
-
bioRxiv - Biophysics 2023Quote: ... we extracted the Zernike weights characteristic of the microscope by acquiring multiple X-PSFs from fluorescent beads (FluoSpheres Tetraspeck beads from ThermoFisher) illuminated with 488 ...
-
bioRxiv - Bioengineering 2023Quote: The normal human fibroblast cell line IMR-90 (ATCC CCL-186) expressing the fluorescent protein GFP was cultured in Dulbecco’s Modified Eagle Medium (Gibco, USA) containing 4.5 g/L D-glucose ...
-
bioRxiv - Cancer Biology 2023Quote: ... The nuclear stain was visualized using a hemocytometer (INCYTO C-Chip; DHC-N01-5) through the Cy5 channel on an EVOS FL Auto Fluorescent microscope (ThermoFisher). Erythrocyte contamination was expressed as the percentage of “round donut-shaped DRAQ5 negative objects on bright-field” over the sum of “round donut-shaped DRAQ5 negative objects on bright-field” and “nuclear stained DRAQ5 positive cells”.
-
bioRxiv - Cancer Biology 2023Quote: ... through GFP (for the Calcein-AM) and RFP (for the Ethidium Homodimer-1) channels on an EVOS FL Auto Fluorescent microscope (ThermoFisher). Viability was expressed as the percentage of live cells (Calcein-AM / GFP positive cells ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated for 20 min at room temperature with 500 nM SYTO RNA Select green fluorescent dye in PBS (Invitrogen). Cells were washed three times with PBS and mounted with Prolong Gold Antifade mounting medium with DAPI (Invitrogen).
-
bioRxiv - Neuroscience 2023Quote: ... and deconvoluted with a point-spread-function inferred from TetraSpeck 100 nm fluorescent microspheres (Thermo Fisher Scientific T7279, Waltham MA) imaged with the same optical setup and processing ...
-
bioRxiv - Microbiology 2023Quote: ... for 16 h at 4°C and with a secondary fluorescent antibody (Alexa-488 anti-sheep diluted 1:50,000; Thermo Fisher) for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... tRNAs were ligated to a Cy3-labelled fluorescent stem-loop RNA/DNA oligonucleotide and subjected to gel electrophoresis using a 10% TBE-UREA denaturing-polyacrylamide gel (Invitrogen). tRNA was visualized using a Licor Odyssey imaging system.
-
bioRxiv - Cancer Biology 2023Quote: Mitochondria content was analyzed using the mean fluorescent intensity of mitochondria structures stained with the Mitotracker green dye (Thermofisher scientific). Mean fluorescent intensity of each image was measured using ImageJ and normalized to the image area ...
-
bioRxiv - Biophysics 2022Quote: ... vulgaris AEP polyps were placed in a custom-made acrylic containers with glass walls filled with Hydra-medium that contained 1-μm green-fluorescent microspheres (Invitrogen). A violet laser pointer mounted on a custom micromanipulator stage was aligned with a plano-concave cylindrical lens with a focal length of −4 mm (Thorlabs ...
-
bioRxiv - Biochemistry 2023Quote: ... PANX1 and its mutants and PANX3 were transiently transfected into HEK293 cells with an enhanced green fluorescent protein (eGFP) using the transfection agent Lipofectamine 2000 (Invitrogen). The cells expressing GFP were selected for patch clamp electrophysiological recordings after 24-36 hours of transfection.
-
bioRxiv - Biophysics 2022Quote: EV concentration was normalized using a spiked-in external standard containing 200 nm orange (540/560) fluorescent beads (Invitrogen, F8809). The concentration of the beads was determined by Flow NanoAnalyzer N30 (NanoFCM ...
-
bioRxiv - Immunology 2022Quote: ... supernatants were discarded and all of the cells from the column-bound fraction and 1/40th of the column flow through were mixed with 20,000 Fluorescent AccuCheck counting beads (ThermoFisher Scientific) to calculate the number of tetramer binding B cells in the column bound fraction ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 µL of the complete medium were substituted with a suspension of fluorescent microparticles (Fluoromax, 0.2 μm, R200, Thermo Scientific) prior to addition of the remaining components ...
-
bioRxiv - Microbiology 2023Quote: ... and mCitrine fluorescent protein were amplified from plasmid pOXC101 (Pollak et al 2021) with the Phusion High-Fidelity PCR Master Mix (ThermoFisher) using primers JES003 (ATATCTCGAGGGCGCGCCTTGACAATTAATC ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by fluorescent secondary antibodies donkey-anti-mouse Alexa-IR800 (1:10000) and donkey-anti-goat Alexa-680 (1:10000, Invitrogen). Fluorescence was detected using the Odyssey CLx imaging system (Licor).
-
bioRxiv - Plant Biology 2023Quote: ... and RAF39 driven by the cauliflower mosaic virus (CaMV) 35S promoter and C-terminally tagged with green fluorescent protein (GFP) was achieved using Gateway LR Clonase II (Invitrogen) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... embryo sections were incubated with a primary antibody against salmon Collagen 1 (#520171; Novotec, France) and then with a secondary antibody conjugated with an Alexa Fluor 594 fluorescent dye (#A11005; ThermoFisher). Nuclei were counterstained with DAPI (0.5µg/ml ...
-
bioRxiv - Neuroscience 2024Quote: α-IgLON5 AABs and pCtrl were conjugated with endosomal-pH sensitive red-fluorescent dye (pHrodoTM iFL Red STP ester, ThermoFisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were washed thrice with 1×PBS and incubated with fluorescent-label-coupled secondary antibodies (Alexa 488 or 633-conjugated goat anti-rabbit IgG 1:1000; Invitrogen) for 2h at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were stained with fluorescent vancomycin (VanFL, in which a BODIPY fluorophore is linked to a vancomycin molecule (Invitrogen)) and/or DAPI (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by the incubation of the fluorescent goat anti-rabbit Alexa Fluor-488 senond antibody (ThermoFisher, Cat# A1008, 1:2000) for 1 hour at room temperature ...
-
bioRxiv - Biophysics 2023Quote: ... This allowed for active stabilization of the system using the standard PSF of non-fluorescent 3 μm polystyrene beads (C37484, Invitrogen) in both lateral and axial dimensions using an open-source active stabilization ImageJ/Micromanager Plugin13 (Supplementary Fig ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were transfected with a mitochondria-targeted fluorescent protein (PDH_GFP) or incubated for 15 min with 100 nM Mitotracker green (Molecular Probes) to stain the mitochondrial network ...
-
bioRxiv - Neuroscience 2023Quote: ... This was followed by overnight incubation with conjugated anti-green fluorescent protein (anti-GFP) rabbit antibody (1:2000; catalog no. A21311; Invitrogen). Finally ...
-
bioRxiv - Plant Biology 2023Quote: ... the entry vector was subsequently recombined into the Gateway-compatible plant binary vectors pGWB505(48) for C-terminal fusion with EGFP (Enhanced Green Fluorescent Protein) through Gateway LR reaction (Invitrogen). The 1053 bp native promoter ...