Labshake search
Citations for Thermo Fisher :
6501 - 6550 of 10000+ citations for Hydrogen Peroxide Fluorescent Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... were transfected with plasmids carrying J08 and 02M04 antibody heavy and the light chains with a 1:2 ratio using ExpiFectamineTM293 Transfection Kit (Thermo Fisher Scientific) as recommended by the manufacturer ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RDB protein was also coupled to DyLight 650 using the DyLight® Amine-Reactive Dyes kit (Thermo Fisher scientific).
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was run on 2% agarose gels and bands were purified using the GeneJET gel purification kit (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer’s protocol ...
-
Lateral organ diversification in plants mediated by the ALOG protein family of transcription factorsbioRxiv - Plant Biology 2019Quote: Gemmalings were incubated in 1/2 B5 medium containing 10uM EdU (Click-iT Edu Alexa Fluor 488 imaging kit; Thermo Fisher, USA) for 3h ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was synthesized from 2 µL of purified and DNase treated RIP-RNA using the Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... cDNA was synthesized from 0.5-2 μg of DNAaseI-treated RNA using RevertAid First-Strand cDNA Synthesis Kit (Thermo Fisher Scientific, K1622), and diluted 1:10 prior to qPCR ...
-
bioRxiv - Plant Biology 2020Quote: Young seedlings were incubated in 20 μM 5-ethynyl-2’-deoxyuridine (EdU) (Click-iT™ EdU Alexa Fluor™ 488 Flow Cytometry Assay Kit, ThermoFisher Scientific/Invitrogen ...
-
bioRxiv - Pathology 2021Quote: ... The cDNA was synthesized from 2 μg of purified RNA using the Revert Aid First Strand cDNA Synthesis Kit (K1622, Thermo Scientific, USA). SYBR Green (K1622 ...
-
bioRxiv - Microbiology 2020Quote: Nuclear and cytoplasmic fractions of MCMV-infected 10.1 cells (2 × 106 cells/well) were lysed stepwise using an NE-PER™ nuclear and cytoplasmic extraction kit (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... 1-2 ug total RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific, #4368814). Real-time PCR was performed using specific primers for ACTN2 (GCTGAAGAAATTGTTGATGG ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA from tissues (2 µg) and hemolymph (200 ng) was used for cDNA synthesis using the RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific). qRT-PCR was performed using PowerUp™SYBR®Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Epidemiology 2019Quote: ... Genomic DNA extraction of the pooled fecal (0.2 ± 0.015 g) or nasal (225 μl) swab samples was conducted using the PureLink Microbiome DNA Purification Kit (Life Technologies, Invitrogen Corp.) followed by RNAse treatment (10 units/hr) ...
-
bioRxiv - Bioengineering 2019Quote: ... live/dead staining was performed by incubation of cells with 2 nM ethidium bromide (dead) and 10 μM Calcein AM (LIVE/DEAD® Viability/Cytotoxicity Kit for mammalian cells, Invitrogen, L3224) for 30 minutes at 37 °C.
-
bioRxiv - Genetics 2020Quote: Proteins were extracted form 20 μL of ammonium bicarbonate resuspended fractions by adding 5 μL of lysis buffer (10% NP40, 2%SDS in PBS) and quantified by BCA protein assay kit (ThermoFisher Scientific, 23225).
-
bioRxiv - Immunology 2021Quote: ... Larvae were then washed twice in PBS-3% BSA and incubated for 2 hours at room temperature in CLICK reaction mixture from Click-iT™ EdU Imaging Kit with Alexa Fluor™ 594 (Invitrogen) made according to manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reverse transcription of mRNA (up to 2 μg/reaction) was performed using the Applied Biosystems High-Capacity RNA-to-cDNA kit (Thermo Fisher Scientific). qRT-PCR (20 ng cDNA/reaction ...
-
bioRxiv - Genetics 2021Quote: ... 1 µg of intact RNA (with a 28S:18S rRNA ratio = 2:1) was reverse transcribed with the RevertAid H Minus Reverse Transcriptase kit (Thermo Scientific, EP0451). Real-time PCR reactions were performed with the Brilliant II SYBR® Green QPCR Master Mix (Agilent ...
-
bioRxiv - Immunology 2021Quote: ... Cells were then washed in FACS buffer (PBS with 2% heat inactivated FBS) and stained with LIVE/DEAD Fixable Violet Dead Cell Stain Kit (Invitrogen, Carlsbad, CA) for 30 min at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... An amount of 2 μg of total RNA was reverse-transcribed into cDNA (High Capacity cDNA Reverse Transcription Kit, Applied Biosystems, USA). The reaction mixture was incubated for 10 minutes at 25 °C ...
-
bioRxiv - Immunology 2020Quote: ... sequence confirmed rDNA (rDNA ID: p20004, supplementary figure 2) was further amplified and purified using PureLink™ HiPure Plasmid Midiprep Kit (ThermoFisher, USA), sequenced ...
-
bioRxiv - Immunology 2020Quote: ... Caco-2 cells were purchased from DSMZ (ACC-169) and transfected with the Hk2 CRISPR plasmid using Lipofectamin reagent kit (Thermo Fisher Scientific). Positive clones were screened via Western blot to generate a monoclonal population termed Caco-2ΔHk2 ...
-
bioRxiv - Immunology 2021Quote: ... Total RNA samples (up to 2 µg) were reverse transcribed using the oligo(dT) primer from the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher®). Molecular detection of SARS-CoV-2 was performed with TaqMan™ Gene Expression Assay (Cat ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was synthesized from 2 μg of total RNA using a RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2022Quote: ... except that they also received 2 injections of 10 mg/kg 5-ethynyl-2’-deoxyuridine (EdU) from the Click-iT EdU Alexa Fluor 647 imaging kit (Invitrogen, Carlsbad, CA), the day after DOX injection (4 DPN ...
-
bioRxiv - Immunology 2022Quote: ... Reverse transcription for up to 2 µg of total RNA was performed using the High-Capacity RNA-to-cDNA Kit (Thermo Fisher Scientific). qPCR was performed in a ViiA 7 Real-Time PCR machine (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... Transfections were performed with 2 × 105 cells using 1 µg of plasmid by electroporation using a Neon electroporation kit (Thermo Fisher Scientific). Prior to imaging ...
-
bioRxiv - Cancer Biology 2022Quote: MIEV and PKCα-KR cells (≥1 × 106/condition) were labelled with CellTrace Violet (CTV; 2 μM) using CellTrace™ Cell Proliferation Kits (Life Technologies) as described previously [14] ...
-
bioRxiv - Bioengineering 2022Quote: ... 2.2 mM LAP was added to half of the samples and 10 µM 5-ethynyl-2’-deoxyuridine (EdU) solution from a Click-iT Plus EdU Cell Proliferation Kit (cat. no. C10637; Invitrogen, Waltham, MA) was added to the other half according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were incubated for 2 hours with 10uM EdU and stained with LIVE/DEAD™ Fixable Violet Dead Cell Stain Kit (Invitrogen #L34955) before fixation ...
-
bioRxiv - Immunology 2022Quote: ... and cDNA synthesis was performed from 2 µg of total RNA using the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher, Waltham, Massachusetts), both according to manufacturers’ protocols ...
-
bioRxiv - Immunology 2022Quote: mRNA expression of type 2 cytokines in ILC2s was measured by using PrimeFlow™ RNA Assay Kit (ThermoFisher Scientific # 88-18005-210) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... 2-5μg of RNA was reverse transcribed into cDNA at 37°C for 2 hours using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368814). cDNA was stored at -20°C and real-time PCR was performed using Taqman primers and probes for Il10 ...
-
bioRxiv - Immunology 2022Quote: ... Cells were stained for surface markers and intracellular cytokines (see Supplementary Table 2) using the FIX & PERM Cell Fixation & Cell Permeabilization Kit (Thermo Fisher Scientific) according to the manufacturer’s information ...
-
bioRxiv - Immunology 2023Quote: ... tumor necrosis factor alpha (TNFα) and C-C motif chemokine ligand 2 (CCL2) concentrations were evaluated using the Ready-SET-Go!™ ELISA kits (ThermoFisher Scientific). CCL24 concentrations were evaluated using the Mouse CCL24/Eotaxin-2/MPIF-2 DuoSet ELISA kit (R&D Systems) ...
-
bioRxiv - Cell Biology 2023Quote: ... Total RNAs (2 μg) were then reverse-transcribed into first strand cDNAs using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μg of total RNA was reverse-transcribed using a high-capacity cDNA archive kit from Applied Biosystems (Foster City, CA, USA) following the supplier’s instructions ...
-
bioRxiv - Immunology 2024Quote: The sandwich ELISA assay was performed with 4 µg/ml coated F(ab’)2 fragments that were generated from full-size antibodies using the Pierce Mouse IgG1 Fab and F(ab’)2 Preparation Kit (Thermo Fisher, 44980) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2024Quote: ... SARS-CoV-2 viral RNA was detected by reverse transcription and amplification using the TaqMan RNA-to-CT 1-Step Kit (Thermo Fisher Scientific), utilizing the primers and probe sequences for viral RNAs are as described before [76] ...
-
bioRxiv - Microbiology 2024Quote: ... were transfected with the plasmid encoding the stabilized SARS-CoV-2 soluble S protein with the Expifectamine kit (GIBCO, Waltham, MA, USA) following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Both reactions provided two products per reaction that were gel purified in a 2% agarose gel using a GeneJet Gel Extraction kit (Thermo Scientific corp.). Each product was cloned using the pGEM®-T Easy vector kit (Promega Corp. ...
-
bioRxiv - Cell Biology 2023Quote: ... Synthesis of cDNA was done with 2 µg of total RNA using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, 4368814). Quantitative PCR (qPCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was synthesized using 2 µg total RNA using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Real-time PCR was performed using a StepOnePlus system (Applied Biosystems ...
-
bioRxiv - Bioengineering 2023Quote: ... The amount of affibody conjugated to the polymer was quantified by dissolving 2-3 mg of HA-Nor-Ox-Affibody in PBS at 2% w/v and determining the protein concentration of the solution using a Pierce 660 Protein Assay Kit (Thermo Fisher Scientific).
-
bioRxiv - Biochemistry 2023Quote: ... 2 μg of RNA per sample were used to synthesize cDNA using the SuperScript III First-Strand kit (Invitrogen cat. no. 12574026). RT-PCR was performed using SYBR green dye (Thermo Fisher Scientific cat ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µg RNA per sample was reverse transcribed into complementary DNA using the SuperScript™ III First-Strand Synthesis kit (Thermo Fisher). Gene expression was quantified by performing quantitative real-time PCR (qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... and up to 2 µg of RNA was used per 20 µl cDNA synthesis reaction (High-Capacity cDNA Reverse Transcription Kit, Thermo Fisher Scientific). 10 µl RT-qPCR reactions consisting of 2 µl cDNA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Each sample (2 μg) of total RNA was reverse transcribed into cDNA using the SuperScript VILO cDNA Synthesis kit (Thermo Fisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Extraction of SARS-CoV-2 RNA was performed using the MagMax Viral/Pathogen Nucleic Acid Isolation kit (Thermo Fisher Scientific, Waltham, MA) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was isolated from MG63 lysates (n = 2 per treatment condition) using the PureLink RNA Mini kit (12183018A, Thermo Fisher Scientific) with DNase set (12185010 ...
-
bioRxiv - Genetics 2023Quote: ... First-strand cDNA was synthesized using 2 μg total RNA with random primer by using RevertAid First Strand cDNA Synthesis Kit (Invitrogen™, USA). RT-PCR was performed using the DreamTaq Green DNA Polymerase (Thermo Scientific™ ...