Labshake search
Citations for Thermo Fisher :
6151 - 6200 of 10000+ citations for Killer cell immunoglobulin like receptor 2DL3 KIR2DL3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: ... followed by two TBT washes and incubation using a pTau AT8 mouse anti-human primary antibody (Thermofisher MN1020) at a dilution of 1:100 ...
-
bioRxiv - Microbiology 2021Quote: ... resuspended in 250 μl PBS-B containing anti-human AlexaFlour-488-conjugated antibody (1:200; Thermo Fisher Scientific) and incubated again for 60 min at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... and human RNase P (RP assay) together with TaqPath™ 1-Step RT-qPCR Master Mix CG (ThermoFisher). A plasmid containing the complete nucleocapsid gene from 2019-nCoV (IDT ...
-
bioRxiv - Cancer Biology 2021Quote: The siRNA duplex (21 nucleotides) against human cath-D siRNA (ID 4180) was purchased from Ambion (Austin, TX), and the firefly luciferase (Luc ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA interference was performed using 10 pmol of duplexes targeting human MLKL (GCAACGCAUGCCUGUUUCACCCAUA, Stealth siRNA from Life Technologies) or non-silencing control duplexes (low-GC 12935111 ...
-
bioRxiv - Biophysics 2021Quote: The pTWIN1 vector containing human Httex1 fused to His6-SUMO was ordered from GeneArt Gene Synthesis (Life Technologies); E ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were then stained with 5 µL FITC anti-human DR4 (Thermo Fisher Scientific, Clone DR-4-02) for 30 min at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... The control human IgG antibody for in vitro and in vivo studies was from Invitrogen (Carlsbad, CA, USA).
-
bioRxiv - Microbiology 2022Quote: ... 2011) were grown in human foreskin fibroblasts (HFF) monolayers in Dulbecco’s modified Eagle’s medium (DMEM) with GlutaMAX (Gibco) supplemented with 10% Nu-Serum (Gibco) ...
-
bioRxiv - Neuroscience 2022Quote: ... The human NPCs sourced from Polymenidou group (UZH) were plated in media supplemented with DMEM/F12 (Thermo Fisher), 0.5X B27-supplement (Thermo Fisher) ...
-
bioRxiv - Microbiology 2022Quote: ... was premised on a commercial human RNaseP primer/probe set (443328, Applied Biosystems, Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Microbiology 2022Quote: ... was premised on a commercial human RNaseP primer/probe set (443328, Applied Biosystems, Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Microbiology 2022Quote: ... supplemented with human recombinant epidermal growth factor (rEGF) and bovine pituitary extract (BPE) plus 2% penicillin-streptomycin (Gibco) at 37°C in 5% CO2 ...
-
bioRxiv - Biophysics 2022Quote: ... and 1 μg/ml Recombinant Human Fibroblast growth Factor-basic (FGFb) (Catalog # 13256-029 Gibco, Thermo Fisher Scientific) at 37°C with 5% CO2 ...
-
bioRxiv - Biophysics 2022Quote: ... and 1 μg/ml Recombinant Human Fibroblast growth Factor-basic (FGFb) (Catalog # 13256-029 Gibco, Thermo Fisher Scientific) at 37°C with 5% CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... EGF-Cy3B was generated using NHS-Cy3B (Cytiva, Marlborough, MA) conjugated to recombinant human EGF (Gibco, ThermoFisher Scientific), using 1:1 labeling stoichiometry as described previously 60 ...
-
bioRxiv - Cell Biology 2022Quote: ... EGF-Cy3B was generated using NHS-Cy3B (Cytiva, Marlborough, MA) conjugated to recombinant human EGF (Gibco, ThermoFisher Scientific), using 1:1 labeling stoichiometry as described previously 60 ...
-
bioRxiv - Cell Biology 2022Quote: ... RNaseH1 was PCR amplified using human RNase H1 cDNA in pENTR221 plasmid (Ultimate ORF clones, IOH4870, ThermoFisher Scientific) as a template ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37 °C and 5% CO2 in EMEM (ATCC) supplemented with 0.01 mg/mL human recombinant insulin (Gibco) and 10% (vol/vol ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary chondrocytes were isolated from the articular cartilage of human joints and expanded in DMEM (high glucose; Gibco) supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... A codon-optimized vector expressing human spatacsin was generated (Baseclear, Leiden, Netherlands) in a gateway compatible system (Thermofisher). The cDNA was transferred by LR clonase into the pDest-47 vector (Thermofisher) ...
-
bioRxiv - Biochemistry 2021Quote: ... labeled with 50 µL Goat anti-Human IgG Fc PE conjugate (ThermoFisher Scientific Invitrogen Catalog # 12-4998-82) diluted in 1.95 mL TBSF for 10 minutes covered on ice ...
-
bioRxiv - Microbiology 2020Quote: Cytokine levels in sinus wash were quantified using a Luminex 35-Plex Human Panel (Invitrogen, Frederick, MD, USA).
-
bioRxiv - Neuroscience 2021Quote: ... human DRGs immediately were cut into 1-2 mm pieces and stored in RNA-later (ThermoFisher, Cat# AM7021). For ISH ...
-
bioRxiv - Neuroscience 2021Quote: ... The primary antibody was incubated overnight at 4°C [human Pax6 polyclonal antibody (1:100, Thermo Fisher Scientific)] ...
-
bioRxiv - Microbiology 2020Quote: ... 100 units/ml Penicillin and 100μg/ml Streptomycin) supplemented with 12.5uL/mL of dynabeads human T-activator CD3/CD28 (Invitrogen), 2μg/mL anti-human IL-12 (PeproTech) ...
-
bioRxiv - Microbiology 2021Quote: ... HEK-293T overexpressing the human ACE2 were kindly provided by Integral Molecular Company and maintained in DMEM (Invitrogen) with 10% fetal bovine serum ...
-
bioRxiv - Microbiology 2022Quote: Toxoplasma gondii tachyzoites were amplified in human foreskin fibroblasts (HFFs, ATCC) in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco) supplemented with 5% of Fetal Bovine Serum (FCS ...
-
bioRxiv - Physiology 2022Quote: Total RNA from human liver biopsies (10-20 mg) was extracted using Trizol extraction (Life Technologies, Carlsbad, CA) followed by a purification step using the GeneJET RNA Purification kit (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: Fresh-frozen human postmortem brain tissues were sectioned at 10 μm onto Superfrost Plus glass slides (Fisher Scientific). Sections were dried for 10 minutes at -20°C and then vacuum sealed in plastic slide boxes and stored at -80°C until use ...
-
bioRxiv - Developmental Biology 2020Quote: ... total RNA were extracted then reverse transcribed using the Ion AmpliSeq Transcriptome Human Gene Expression kit (Thermofisher Scientific). The cDNA libraries were amplified and barcoded using Ion AmpliSeq Transcriptome Human Gene Expression core panel and Ion Xpress Barcode Adapter (Thermofisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... at 4% haematocrit in supplemented RPMI media (RPMI-HEPES, 0.2% NaHC03, 5% heat-inactivated human serum [Australian Red Cross], 0.25% AlbumaxII [GIBCO] ...
-
bioRxiv - Genomics 2019Quote: ... Primary antibodies (anti-human CD47-APC; clone CC2C6, BioLegend, Cat. #323123/4, RRID: AB_2716202/3; and clone B6H12.2, ThermoFisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Human MSCs at passage 2 were maintained in growth media consisted of alpha-MEM (Life Technologies, 32561--037) supplemented with 17% FBS (Sigma-Aldrich ...
-
bioRxiv - Pathology 2020Quote: ... Anti-human Alexa Fluor 594-antibody was used for detection (Molecular probes®, ThermoFisher Scientific, Carlsbad, CA, USA). For nuclear staining ...
-
bioRxiv - Microbiology 2021Quote: Primary HFFF immortalised with human telomerase (HFFF-TERTs) (96) were grown in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... Raw data were searched with the Mascot search engine (MatrixScience, Boston, MA) against a recent human database (2015) on Proteome Discover Version 2.1.1.21 (Thermo Scientific) using the following parameters ...
-
bioRxiv - Neuroscience 2019Quote: ... human Ad5 genomic plasmid (pBHGfrtΔE1,3FLP; Microbix) and each pDC511-LRRK2 shuttle plasmid were introduced by calcium phosphate (Invitrogen) transfection into stable Tet-On-inducible E2a cells (E2T cells ...
-
bioRxiv - Neuroscience 2019Quote: FLAG-tagged human LRRK2 proteins were enriched from injected rat striatum using Protein G-Dynabeads (50 µl; Invitrogen) pre-coupled with mouse anti-FLAG-M2 antibody (5 µg ...
-
bioRxiv - Developmental Biology 2021Quote: ... hEPSCs were grown using ‘human Expanded Potential’ (hEP) medium consisting of DMEM/F12 (Thermo Fisher Scientific, 11320-033), Neurobasal-A (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Tetramers were mixed with the following anti-human antibody cocktail: anti-CD16 APC-eFluor780 (Invitrogen, #47-0168-41), anti-CD8α APC-eFluor780 (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: SNP 6.0 analysis was performed by Aros AB (Denmark) using a Genome-Wide Human SNP Array 6.0 (Affymetrix) on RPE1 cells and two edited RPE1 lines derived from the parental RPE1 line ...
-
bioRxiv - Evolutionary Biology 2020Quote: Cells in 6-well plates were transfected with 1 ug human or cow CD44-promoter-pNL2.1 or empty vector pNL2.1 using Lipofectamine 3000 (Invitrogen) as manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was extracted from both medial and adventitia layer of the aortic wall and subsequently sequenced on HTA 2.0 (Human Transcriptome Array 2.0 - Affymetrix) platform.
-
bioRxiv - Neuroscience 2021Quote: ... 200 µg of human serum) were separated by SDS-PAGE on 3-8% tris-acetate gels (NuPAGE, Invitrogen) under reducing conditions at 150 V (cellular fraction ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 1% penicillin–streptomycin in 6-well plates coated with truncated recombinant human vitronectin (Thermo Fisher Scientific). The iPSC line was previously assessed for pluripotency and normal karyotype.33 For differentiation ...
-
bioRxiv - Synthetic Biology 2021Quote: BMP4 concentration released into the media was quantified using the BMP-4 Human ELISA Kit from (ThermoFisher, EHBMP4). Standards and protocols were done according to the instructions of the kit ...
-
bioRxiv - Immunology 2021Quote: ... and anti-Spike IgG was quantified using a Human SARS-CoV-2 Spike (Trimer) IgG ELISA Kit (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Addgene No. 154106) are previously described. Human codon-optimized S (GenBank No. YP_009724390.1) was subcloned into pCEP4 (Invitrogen) from pUC57-2019-nCoV-S(Human ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-human Ig Alexa Fluor 488 (A11013) or anti-rabbit Ig Alexa Fluor 568 (A11036; Thermo Fisher Scientific), according to primary antibody species.