Labshake search
Citations for Thermo Fisher :
551 - 600 of 631 citations for R + SCH 23390 hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... the PCR products from using the primer DBH-WT-F and DBH-3’junc-R 5’- TCTGAAGAATAGCTTCTCACAAgagctcag were subcloned into the pCR Blunt II TOPO vector (Zero Blunt TOPO PCR Cloning Kit, Thermo Fisher Scientific) and sequenced using M13-Foward and M13-Reverse primers.
-
bioRxiv - Biochemistry 2024Quote: ... at 0.8 mg/ml were applied to glow discharged Quantifoil® 300 mesh R 0.6/1 grids and flash frozen in liquid ethane using FEI Vitrobot MAG IV (Thermo Fisher Scientific). For AtRuvBL1-AtRuvBL2a complex ...
-
bioRxiv - Bioengineering 2024Quote: ... For endogenous RNA trans-splicing experiments 400 ng of dCas13 expression plasmid was mixed with 400 ng of rcRNA expression plasmid 10ul R Buffer (Thermo Fisher Scientific). For experiments where only dCas13 expression plasmid or rcRNA plasmid was transfected ...
-
bioRxiv - Cell Biology 2023Quote: ... two crRNA:tracrRNA guides (for sequences see Supplementary Table 7) for upstream and downstream cleavage complexed with Alt-R Cas9 nuclease 3NLS (ThermoFisher Scientific, 1074182) were prepared using following protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... HaCaT cells were transfected with a 10 nM duplex of crRNA and Alt-R CRISPR-Cas9 tracrRNA tagged with ATTO 550 (Integrated DNA Technologies) using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: mRNA samples from ZF-R-transfected T cells were reverse transcribed to cDNA using a Power SYBR Green Cells-To-CT kit (Thermo Fisher Scientific) and qPCR reactions were performed using QuantiFast Multiplex PCR Master Mix (w/o ROX ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were washed in PBS and 1 x 106 cells were resuspended in Buffer R of the Neon Transfection System (Thermo Fisher Scientific). 12 ng of sgRNA and 5 ng of electroporation- ready Cas9 protein were mixed to form the Cas9/sgRNA RNP complex and the reaction was mixed and incubated at 37 °C for 5 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μl of IP eluate was separated on a 4-12% Novex Tris-glycine gel and stained with Coomassie Brilliant Blue R-250 Dye (Thermo Scientific, 20278) for 30 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 0.01 µg/ml soluble human anti-CD3 (R & D; clone UCHT1) and 0.1 µg/ml soluble human anti-CD28 (Life Technologies; clone CD28.2) for 3 days before infection ...
-
bioRxiv - Microbiology 2023Quote: Two complimentary oligodeoxynucleotides gRNA F and gRNA R (Table 1) were annealed in a thermocycler and the resulting dsDNA fragment was then ligated into the BbsI (ThermoFisher Scientifc, USA) site of linearized pX459 ...
-
bioRxiv - Microbiology 2023Quote: ... and the SV40 early mRNA polyadenylation signal was amplified from pcDNA3.1(+)IRES GFP using the forward primer (CMVP F) containing EcoRI restriction site and the reverse primer (PolyA R) containing MluI (ThermoFisher Scientifc, USA) restriction site.
-
bioRxiv - Genomics 2023Quote: ... Cas12a Ultra (1 µM) (Cpf1) from Integrated DNA Technologies (IDT) and crRNA (1 µM) were pre-incubated in resuspension buffer R (Thermo Fisher Scientific) at room temperature and mixed with cells (0.125 ×105 /µL) ...
-
bioRxiv - Developmental Biology 2023Quote: ... R: 5′- AAAGCACCGACTCGGTGCCAC-3′) and used as a template for in vitro transcription using MEGAshortscript T7 kit (Ambion/Thermo Fisher Scientific AM1354). 2ng gRNA was injected together with 1.9nM Cas9 protein (New England Biolabs M0386T ...
-
bioRxiv - Developmental Biology 2023Quote: ... R: 5′- AAAGCACCGACTCGGTGCCAC-3′) and used as a template for in vitro transcription using MEGAshortscript T7 kit (Ambion/Thermo Fisher Scientific AM1354). 2ng gRNA was injected together with 1.9nM Cas9 protein (New England Biolabs M0386T ...
-
bioRxiv - Developmental Biology 2023Quote: ... mSostTALEN-B-L and -R mRNAs were synthesized and a polyA tail was added using the mMESSAGE mMACHINE T7 ULTRA Kit (Ambion, Austin, TX) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmid minipreps were sequenced by first being PCR-amplified using the T7-Prom-F/T7-Term-R primers and cleaned up using the ExoSAP-IT PCR Product Cleanup kit (Thermo Fisher, 78200). Sanger sequencing was then carried out by SourceBioscience for verification.
-
bioRxiv - Cell Biology 2023Quote: ... and Alt-R® CRISPR-Cas9 tracrRNA Atto550 labeled, IDT) and recombinant Cas9 protein (Alt-R® S. p. HiFi Cas9 Nuclease V3, IDT) using Lipofectamine™ CRISPRMAX (Invitrogen) and cultured for 48 h in the presence of an HDR enhancer (final concentration 20 μM ...
-
bioRxiv - Biophysics 2024Quote: ... Chromatography of peptides prior to mass spectral analysis was accomplished using a capillary emitter column (PepMap○R C18, 3 µM, 100 Å, 150 x 0.075 mm, Thermo Fisher Scientific) onto which 2 µl of extracted peptides were automatically loaded ...
-
bioRxiv - Molecular Biology 2024Quote: ... The AAV-HR targeting the negative region of R-loops (AAV-HRneg) of the albumin locus was constructed by topo cloning (Thermo Fisher, 451245) while the homology arms were PCR amplified from gDNA extracted from murine liver (DNA plasmid sequences can be found in the supplementary material section).
-
bioRxiv - Cell Biology 2024Quote: ... IDT) and crRNA (1 µM) for the Cpf1 system were pre-incubated at room temperature in resuspension buffer R (Thermo Fisher Scientific). Cells (0.125 × 10^5 /µL) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µg Cas9 nuclease and 200 ng sgRNA1 (or 100 ng sgRNA1 and 100 ng sgRNA2) with/without 500 ng HDR donor template were added to 10 μl Resuspension Buffer R (Thermo Fisher Scientific) followed by vortexing and incubation at RT for 5 min to form Cas9 RNP complexes ...
-
bioRxiv - Neuroscience 2024Quote: ... The pHOGL3/4.5 double mutant was obtained from the pHOGL3/4.5 triple mutant in which mutation C>T was created into the mutated EBox by a rapid-site-directed-mutagenesis using the following non-overlapping primers (F: cacgtgacccgccgagcata; R: ggccaggcggaacagc) and Platinum™SuperFi™II DNA Polymerase (Invitrogen). pGL3 Firefly Luciferase basic empty vector (Promega ...
-
bioRxiv - Plant Biology 2024Quote: ... by using TaOr-GFP-F and TaOr-GFP-R primers (Supplementary table S1) and Gateway™ BP Clonase™ II Enzyme mix (Invitrogen) as per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... HDLECs were stained for LYVE-1 using primary antobody R&D systems (Bio-Techne AF2089) and secondary antibody donkey anti-Goat (ThermoFisher Scientific, A32849). Monocyte rolling experiments ...
-
bioRxiv - Genomics 2024Quote: ... 2µl of Alt-R® Cas9 Electroporation Enhancer (IDT, 075915), and 5µl of Alt-R™ HDR Enhancer V2 (IDT, 10007910) using the Neon™ Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: 293T cells were transfected with a pool of 3 P2X7 (R) -targeting siRNAs (TGACAGAAATTGACAACAA; AGACAAGAACAACTCCAAA; ACAGTGTCTTAACATTCAA) or control siRNA (CAAACAGAAUGGUCCUAAA) (50 μM) using Lipofectamine™ RNAiMAX transfection reagent (Invitrogen, 13778100) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were grown in suspension culture in SCC media consisting of: SILAC-Freestyle medium (a gift from the R&D Cell Biology Department, Thermo Fisher Scientific) supplemented with 1% dialyzed fetal bovine serum (Gibco #26400044) ...
-
bioRxiv - Cell Biology 2024Quote: ... Enriched cKit+ cells were then incubated with an anti-Lineage antibody cocktail (including biotinylated Gr1[LY-6G/LY-6C], CD11b, CD4, CD8a, CD45R[B220], IL7-R, TER119 (all from Thermo Fisher Scientific)) for an additional 30 minutes ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... followed by staining with Coomassie Brilliant Blue R-250 (Sisco Research Laboratories Pvt. Ltd, India) and imaging under an iBright CL1000 (Thermo Fisher Scientific, USA) gel documentation system ...
-
bioRxiv - Molecular Biology 2020Quote: ... HUVECs were successively stained with goat anti syndecan-4 (Cat No: AF2918-SP, R&D Company, USA) and rabbit anti-goat IgG secondary antibody (Cat No: A27018, Thermo Fisher Scientific, USA). Then the syndecan-4 expression on HUVECs was measured by flow cytometry with a BD Biosciences LSR II (BD Biosciences ...
-
bioRxiv - Biochemistry 2020Quote: ... Homogenized tissues were incubated on ice for 30 min and centrifuged for four minutes at 8,000 rpm at 4°C in an accuSpin Micro R centrifuge (ThermoFisher Scientific, Waltham, MA, USA). The resultant pellets were then washed with acetone three times ...
-
bioRxiv - Molecular Biology 2021Quote: ... oligonucleotides from homologous regions D-ORF5 5′CCGctgagCAAGGTAGCCTCGTCTATTGGAC 3′ and R-ORF7 5′CCGctcgagTTCTTCATCTTCAATATTATGTC3′ were used using the PCR Reagent System Kit (Invitrogen, Life Technologies Inc.). The reaction mixture was prepared with l00 ng of recombinant TnGV DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... the Cas12a RNP complex was then mixed with 1 × 105 cells in Neon R buffer at the desired dosage and electroporated using Neon® Transfection System 10 L Kit (Thermo Fisher Scientific) using the suggested electroporation parameters ...
-
bioRxiv - Molecular Biology 2022Quote: ... the Cas12a RNP complex was then mixed with 1 × 105 cells in Neon R buffer at the desired dosage and electroporated using Neon® Transfection System 10 L Kit (Thermo Fisher Scientific) using the suggested electroporation parameters ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantifoil cryo-EM grid (R 1.2/1.3 Cu 300 mesh) and plunge frozen in liquid ethane using a Vitrobot Mark IV (Thermo Fisher Scientific, Waltham, MA, USA) fitted with Whatman #1 filter paper for blotting at 4 °C and 100% humidity for 3.5 s at blot force 0 ...
-
bioRxiv - Microbiology 2020Quote: ... or the same amount of control IgG (R&D, Cat. AB-105-C) together with 40 μl of Dynabeads Protein G (Thermo Scientific, Cat. 10003D) at 4 °C overnight ...
-
bioRxiv - Developmental Biology 2022Quote: ... sections were incubated in primary antibody (chicken anti-GFP, Aves labs GFP-1010, 1/500; goat anti-PDGFRA, R&D Systems AF1062, 1/200; rat anti-SOX2, ThermoFisher 14-9811-82 ...
-
bioRxiv - Cell Biology 2021Quote: The monoclonal antibodies, anti-CD9 Alexa Fluor® 488-conjugated (R & D systems, Canada) or anti-CD63 Alexa Fluor® 488-conjugated (Invitrogen, ThermoFisher Scientific) or anti-CD81 Alexa Fluor® 488-conjugated (R & D systems ...
-
bioRxiv - Microbiology 2022Quote: ... organoids were dissociated from the Cultrex Basement Membrane Extract (BME, R&D Biosystems, Bio-Techne, 3533- 001-02) using dispase (ThermoFisher Scientific, 17105-041) for 30 min at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: Quiescent cells were incubated with 0.25% trypsin-EDTA to dislodge the cells and then treated with defined trypsin inhibitor (Gibco DTI R-007-100). The cells were then seeded onto 12-mm poly-L-lysine coated glass coverslips (Corning 354085 ...
-
bioRxiv - Microbiology 2022Quote: ... Sections from the AstV-ND-1 patient’s brain and a control human brain were mounted onto microscope slides and hybridized with either astrovirus or actin probes using a QuantiGene (R superscript circularized) ViewRNA ISH Tissue 2-Plex Assay kit (Affymetrix Cat No. QVT0012).
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Cell Biology 2023Quote: Synthetic sgRNAs to knockout AHR and TFAP2A gene, and purified Edit-R Cas9 nuclease protein (NLS, #CAS11200) were bought from Invitrogen (Waltham, MA, USA) and IDT Technologies (Coralville ...
-
bioRxiv - Bioengineering 2023Quote: ... Electroporation was conducted with an optimized parameter of a 1150 V/30 ms/1 pulse with buffer R in a Neon Transfection System (Thermo Fisher Scientific, USA). The PGC culture medium in the presence of puromycin (0.1 μg/mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... BMP6 was a generous gift from OSTEOGROW. ERFE was detected using DYKDDDDK Epitope Tag HRP-conjugated Antibody (R&D, Cat. # HAM85291) and FAM132B Polyclonal Antibody (Invitrogen, Cat. #PA5-67448). Recombinant ALK3-Fc fusion protein was purchased from R&D (Cat ...
-
bioRxiv - Developmental Biology 2023Quote: ... According to the manufactures’ instructions including two rounds of amplification by using a (RNA extraction kit) Message Amplification II R (Thermo fisher, https://www.thermofisher.cn/).
-
bioRxiv - Neuroscience 2023Quote: ... for 5 min each time and subsequently incubated with blocking buffer (5% goat serum [R&D Systems, Minneapolis, MN, Catalog no. S13110], 1% bovine serum albumin [Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse monoclonal anti-rat DC217 (1:200, Axon Neuroscience R&D SE, Bratislava, Slovakia) and polyclonal anti-rat pThr212 (1:1000, Invitrogen Life Technologies, Carlsbad, CA). For total tau ...
-
bioRxiv - Microbiology 2023Quote: ... The Falcon tubes were centrifuged at 6,000 rpm for two minutes at 4°C in an Eppendorf Centrifuge 5810 R from Fisher Scientific (Waltham, MA, US) to separate the biological samples from the Softdisc discs ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 μl of crRNA and tracrRNA (stocks 100 μM) were annealed together at 95°C in 4 μl of R buffer (NEON transfection system, Thermo Fisher, Cat. #MK10096). After cooling for 10 mi at RT ...