Labshake search
Citations for Thermo Fisher :
201 - 250 of 631 citations for R + SCH 23390 hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: Total RNA of cells was extracted after treatment of cells with sertraline hydrochloride for 72 h using TRIzol reagent (Cat no. 15596-018, Ambion, Life Technologies, USA). Complementary DNA (cDNA ...
-
bioRxiv - Biochemistry 2023Quote: ... 500 µL of perfusate was dried in 0.5 mL V-vials and reconstituted in 50 μL of 20 mg/mL hydroxylamine hydrochloride (CAS# 5470-11-1; Acros organics, New Jersey) in pyridine (CAS#25104 ...
-
bioRxiv - Immunology 2024Quote: ... and reduced for 30 min at 37°C with 1:125 dilution of Tris (2-carboxyethyl) phosphine hydrochloride (TCEP) (ThermoFisher, Waltham, MA, USA).
-
bioRxiv - Systems Biology 2023Quote: ... Val-Tyr-Val, methoxyamine hydrochloride (MeOX), N-methyl-N-(trimethylsilyl)-trifluoroactamide (MSTFA), and pyridine (Anhydrous, 99.8%) were all purchased from Fisher Scientific (Hampton, NH, USA). Fatty acid methyl esters (FAMEs ...
-
bioRxiv - Biophysics 2022Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, Catalog No. 22980) and Sulfo-NHS (N-hydroxysulfosuccinimide, Catalog No. 24510) were purchased from Thermo Scientific (Waltham, MA, US). Phosphate-Buffered Saline (PBS ...
-
bioRxiv - Biochemistry 2020Quote: ... washed with PBS and resuspended in electroporation Buffer R (Thermo Fisher) to a final volume of 90 μl ...
-
bioRxiv - Cancer Biology 2021Quote: ... R-GECO-nls [32] was transfected using Lipofectamine 3000 (ThermoFisher Scientific) 24-48 hours prior to imaging ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 0.2% Coomassie Brilliant Blue R-250 dye (ThermoFisher Scientific, U.S.A.). The sucrose encourages the larvae to consume the virus solution and the dye allows us to recognize larvae that have consumed half their body length of virus solution and are therefore considered successfully inoculated.
-
bioRxiv - Developmental Biology 2020Quote: ... ReverseLJtranscription (RT) was performed using SuperScript(R) III Reverse Transcriptase (Invitrogen), as recommended by the manufacturer ...
-
bioRxiv - Immunology 2022Quote: ... isotype control antibody (R-Cell Signaling Technology or M-Thermo Fisher), or anti-Flag M2 magnetic beads (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... and R-phycoerythrin goat anti-mouse IgM 1:400 (Invitrogen, A10689) were added for 30 min at room temperature ...
-
bioRxiv - Plant Biology 2021Quote: ... The CREL gene was then subcloned using L/R clonase (Invitrogen) downstream to the 35S promoter to generate 35S::CREL.
-
bioRxiv - Cancer Biology 2022Quote: ... Qubit(r) RNA HS Assay Kit (Invitrogen; Q32852, San Diego, CA), and Qubit(r ...
-
bioRxiv - Bioengineering 2023Quote: ... goat IgG (#AB-108-C, Invitrogen R&D Systems, Minneapolis, MN) was added at 20 μg/mL in 100 μl stain buffer per 1×106 cells and incubated for 20 min at room temperature protected from light ...
-
bioRxiv - Genomics 2023Quote: ... we used SiteClick R-PE Antibody Labeling Kit (Life Technologies S10467) to crosslink 5’ DBCO-modified 18-nt DNA oligonucleotides (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... and streptavidin-R-phycoerythrin (4 μg/mL) (Life technologies, Illkirch, France) on an orbital shaker and protected from light ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were re-pelleted for resuspension in Buffer R (Invitrogen, MPK10025) containing 500 ng of plasmid to a final density of 1x106 cells/mL ...
-
bioRxiv - Genetics 2022Quote: ... with 100-µL reaction volume of resuspension (R) buffer (Thermo Fisher), mixed with CRISPR plasmids and targeting donor plasmids for electroporation in these PFFs ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 0.2% Coomassie Brilliant Blue R-250 dye (ThermoFisher Scientific, U.S.A.) were placed into each dish using a syringe ...
-
bioRxiv - Cell Biology 2024Quote: The following human (h) and rat (r) TaqMan assays (Thermo Fisher) were used ...
-
bioRxiv - Biochemistry 2024Quote: ... While R-β-actin was labelled with Alexa Fluor 488 (Invitrogen). Actin was polymerized at room temperature for 1 hour by adding MEK polymerization buffer (20 mM MgCl2 ...
-
bioRxiv - Neuroscience 2024Quote: ... siRNA scrambled (siRNAscr; Silencer R Negative Control siRNA #1, AM4635, Ambion) in Opti-MEM medium with Lipofectamine RNAiMax (Thermo Scientific ...
-
bioRxiv - Genomics 2024Quote: ... and electroporated into MegaX DH10B T1 R electrocompetent cells (ThermoFisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Gels were either stained using the Coomassie R-250 Staining kit (ThermoFisher) or used for in-gel activity ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were washed with PBS and resuspended in Buffer R (Thermo Fisher) at a concentration of 8 x 107 cells ml-1 ...
-
bioRxiv - Cell Biology 2022Quote: ... (r): caatgcgtccactctctcat was performed using PowerUp− SYBR− Green Master Mix (A25741; ThermoFisher) on a CFX384 Real-Time PCR Detection system (Biorad) ...
-
bioRxiv - Neuroscience 2020Quote: ... resuspended in a final volume of 13 μL in buffer R (Invitrogen) by electroporation (1200 V ...
-
bioRxiv - Microbiology 2021Quote: ... and 0.1% (w/v) Coomassie Brilliant Blue R-250 (ThermoFisher, Waltham MA) and de-stained until desired background was reached and imaged.
-
bioRxiv - Cell Biology 2022Quote: ... 10% conditioned R-Spondin medium and 40% DMEM:F12 containing B27 (Gibco, 0.5x), HEPES (Gibo ...
-
bioRxiv - Cell Biology 2022Quote: ... 2×106 cells were collected and resuspend in 10μl R buffer (Invitrogen), 1μg DNA of each plasmid construct were added and electroporated using the Neon transfection system (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Peptide-loaded monomers were conjugated into tetramers using R-PE streptavidin (Invitrogen), PE-Cy5 streptavidin (BD) ...
-
bioRxiv - Immunology 2020Quote: ... Supernatants were analyzed for lupus-associated cytokines by ELISA (Invitrogen / R&D). Whether haptoglobin (Hp ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were incubated with 500 ng/mL R-phycoerythrin (ThermoFisher, Waltham, MA) for 10 minutes and then imaged ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Qubit(r) DNA HS Assay Kit (Invitrogen; 32854, San Diego, CA). For mRNA library preparation ...
-
bioRxiv - Immunology 2022Quote: ... albicans were labeled with Rhodamine Green-X (Life Technologies, Invitrogen, R-6113) as previously described (Marakalala ...
-
bioRxiv - Immunology 2022Quote: ... albicans were labeled with Rhodamine Green-X (Life Technologies, Invitrogen, R-6113) as previously described (Marakalala ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ribosomal (r)RNAs were depleted using the Ribominus Eukaryote v2 kit (Ambion). Alternatively ...
-
bioRxiv - Immunology 2023Quote: ... while activated CD8 T cells were resuspended in R buffer (Invitrogen MPK1096) and electroporated using 1600V ...
-
bioRxiv - Immunology 2023Quote: ... Mo were washed with PBS and resuspended in Buffer R (Thermo Fisher) at a concentration of 1x106 cells/10 μL ...
-
bioRxiv - Neuroscience 2024Quote: ... and pericytes in the OGD/R model using a Trizol reagent (Invitrogen). The mRNAs of genes from the prediction analysis ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10% conditioned R-Spondin medium and 40% DMEM:F12 containing B27 (Gibco, 0.5x), HEPES (Gibo ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3x105 cells were resuspended in 120 μl of R-buffer (Invitrogen) supplemented with 1 μg GFP plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were washed in PBS and resuspended in Resuspension Buffer R (Invitrogen). Then ...
-
bioRxiv - Cancer Biology 2022Quote: ... and resuspended in 85 µL of the electroporation buffer R (Thermo Fisher). Increasing amounts of recombinant protein samples for each construct (0 ...
-
bioRxiv - Immunology 2024Quote: ... The cells were resuspended in 35 mL Buffer R (Thermo Fisher Scientific) and combined with 8 mL of the previously prepared Cas9-RNP complex with repair ssODN ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA concentration was quantified in R Qubit dsDNA HS Fluorometer (Life Technologies, Sweden). One 96-plex genotyping-by-sequencing libraries were performed with MsII digestions (Elshire et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the cell pellet resuspended in cold Neon™ Buffer R (ThermoFisher MPK10096) at a concentration of 5,000 - 20,000 cells/μL.
-
bioRxiv - Neuroscience 2022Quote: ... 2.5×106 cells were resuspended in 120µL of R Buffer (ThermoFisher Scientific, MPK10096) and mixed with 1.5 µg each of AAVS1-TALEN-L and AAVS1-TALEN-R ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cas9 Nuclease 3NLS (IDT, #1074181) was resuspended in Resuspension Buffer R (Thermo Fisher) to a final concentration of 36 µM ...
-
bioRxiv - Neuroscience 2020Quote: ... The secondary antibodies R-phycoerythrin goat anti-rabbit IgG 1:500 (Invitrogen A10542) and R-phycoerythrin goat anti-mouse IgM 1:400 (Invitrogen ...