Labshake search
Citations for Thermo Fisher :
251 - 300 of 631 citations for R + SCH 23390 hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Gels were then stained in Coomassie brilliant blue R-250 solution (Fisher Scientific) and de-stained in 5% (vol/vol ...
-
bioRxiv - Immunology 2022Quote: ... to inserted downstream of HA-R by GeneArt Gibson Assembly (Thermo Fisher, A46624).
-
bioRxiv - Cancer Biology 2023Quote: ... R-spondin1-Conditioned Media (final concentration, 10%) (Thermo Fisher Scientific, Waltham, MA, USA), and afamin/Wnt3A conditioned media (Stony Brook Medicine Biobank ...
-
bioRxiv - Biochemistry 2024Quote: ... the cell pellet was resuspended in a low volume of “Buffer R” (ThermoFisher) or a similar-performing electroporation buffer of 250 mM sucrose ...
-
bioRxiv - Immunology 2024Quote: ... then stained with Coomassie dye R-250 (ImperialTM Protein Stain, 24615, Thermo Scientific), bands were cut and submitted to the Taplin Biological Mass Spectrometry Facility ...
-
bioRxiv - Cancer Biology 2024Quote: ... and sgRNAs at a 1:3 molar ratio in Neon buffer R (Invitrogen) and incubating at room temperature for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... ~5×105 Jurkat cells were electroporated in a solution of R-buffer (100μL; Invitrogen) containing 1ug of plasmid (HSV-1 full ...
-
Vegetative nuclear positioning is required for calcium and ROS signaling in Arabidopsis pollen tubesbioRxiv - Plant Biology 2020Quote: ... NLS-YC3.6 and R-GECO1 were cloned into pENTR/D-TOPO vectors (Life Technologies) and then moved to LAT52pro::pH2GW7 via the Gateway® LR reaction (Life Technologies).
-
bioRxiv - Molecular Biology 2020Quote: ... after which supernatants were incubated with 3 μl anti-V5 (Invitrogen R-960-25) or anti-HA (Invitrogen 26183 ...
-
bioRxiv - Immunology 2020Quote: ... and resuspended at 5 million cells/ 100 μl in Neon R buffer (Invitrogen, #MPK10096). For H-targeting ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were resuspended in Buffer R of the Neon Transfection System (Thermo Fisher Scientific) at a concentration of 2×107 cells/ml ...
-
bioRxiv - Genetics 2020Quote: ... according to the manufacturer’s instructions but with OptiMEM instead of Neon R Buffer (Invitrogen). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... preservation at room temperature in RNAlater™ (RNAlater™ Stabilization Solution, Invitrogen; “R” treatment); a combination of RNAlater™ and flash freezing (“RF” treatment) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2×10^5 individualized hESCs were resuspended in 10 μL Resuspension Buffer R (Invitrogen) containing CRISPR ribonucleoproteins (Cas9 protein+sgRNA ...
-
bioRxiv - Biochemistry 2020Quote: ... and then incubated for 20 minutes with R-phycoerythrin-labeled streptavidin 1:750 (Invitrogen). Lastly ...
-
bioRxiv - Immunology 2020Quote: ... and resuspended at 0.5 million cells/ 10 μl in Neon R buffer (Invitrogen, MPK10096). 1 μg of each gRNA ...
-
bioRxiv - Genetics 2022Quote: ... mCherry-R and ReCOIN cassette were PCR amplified and cloned into NheI (Thermo Fisher) and NotI (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: ... and stained with Coomassie Brilliant Blue R-250 or SYPRO ruby (Invitrogen, Eugene, Oregon) and visualized using a FluorChemE imager (Protein Simple ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The reconstituted library was then transformed into MegaX DH10B T1 R electrocompetent cells (ThermoFisher), cultured and purified for the initial RISE cycle ...
-
bioRxiv - Genetics 2023Quote: ... 2×10^5 individualized iPSCs were resuspended in 10 μL Resuspension Buffer R (Invitrogen) containing CRISPR ribonucleoproteins (Cas9 nuclease +sgRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... OriLyt-R DNA was synthesized using BAC16 KSHV sequence (accession MK733609) via GeneArt (ThermoFisher) and subcloned into pRSET-A plasmid via NdeI/XhoI ...
-
bioRxiv - Immunology 2024Quote: ... we added 50µL of Streptavidin-R-phycoerythrin (1µg/mL) (10655783; Fisher Scientific; Brussel, Belgium) to each well ...
-
bioRxiv - Neuroscience 2024Quote: ... The R&D systems™ recombinant mouse adiponectin protein was ordered from Fisher Scientific.
-
bioRxiv - Biophysics 2024Quote: ... The cell pellet was then resuspended in R buffer (Neon Transfection Kit, Thermo Fisher). Appropriate amounts of plasmids (100 ng for the PMT-F-tractin/PMT/GPI/F-tractin plasmids ...
-
bioRxiv - Developmental Biology 2024Quote: Freshly extracted sperm were centrifuged at 400 G (Thermo Scientific Legend Micro 17 R) for 5 min at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... Gels were stained in Coomassie brilliant blue R-250 (0.25% w/v) solution (Fisher Scientific) and de-stained in 5% (vol/vol ...
-
bioRxiv - Cell Biology 2020Quote: ... and Alt-R CRISPR– Cas9 tracrRNA (Integrated DNA Technologies) with Lipofectamine RNAiMAX transfection reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: Secondary antibodies used were as follows (Alexa Fluor conjugates, Thermo Fisher; HRP conjugates, R&D):
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from 40 adults of Oregon-R using TRIzol reagent (Thermo Fisher) followed by chloroform purification and isopropanol precipitation ...
-
bioRxiv - Cancer Biology 2020Quote: ... The gel was subsequently stained with Imperial stain (Coomassie dye R-250, Thermo Fisher 24615) according to the manufacturer’s recommendation ...
-
bioRxiv - Cell Biology 2021Quote: ... After a wash with PBS they were resuspended in Buffer-R (included in Invitrogen, #MPK1025) with 2 μg/μL each of plasmids ...
-
bioRxiv - Biophysics 2021Quote: ... and the cells were resuspended in R buffer (Neon Transfection Kit, Thermo Fisher Scientific, Singapore). Suitable amounts of plasmids were mixed with the cells for transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Rhodamine Red™-X goat anti-mouse IgG (1:1000 Invitrogen - catalog # R-6393). Nuclei were stained with DAPI.
-
bioRxiv - Molecular Biology 2021Quote: ... and Rhodamine Red™-X goat anti-mouse IgG (1:2000 Invitrogen - catalog # R-6393). Nuclei were stained with DAPI ...
-
bioRxiv - Immunology 2020Quote: ... Supernatants were assessed for the presence of lupus-associated cytokines by ELISA (Invitrogen / R&D). In analogous cultures of splenocytes ...
-
bioRxiv - Immunology 2023Quote: ... was mixed with 2 μL Buffer R for each reaction (Neon Transfection System Kit, Invitrogen), then mixed with 5 μL annealed crRNA:tracrRNA duplex ...
-
bioRxiv - Immunology 2023Quote: ... followed by horseradish peroxidase-conjugated rabbit anti-goat IgG (1:250, R-21459, ThermoFisher Scientific). Immunoreactivity was visualized using 3,3’-diaminobenzidine ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell pellets were suspended in 10µl of the Neon transfection buffer R (ThermoFisher Scientific, MPK1096). Cells were transiently transfected with mCherry (gift from Michael Davidson ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNA concentration was measured fluorometrically with Qubit R dsDNA assays (Thermo Fisher Scientific, USA).
-
bioRxiv - Plant Biology 2023Quote: ... CP-R: 5’GGGGACCACTTTGTACAAGAAAGCTGGG TCCTGCACAGAACCTACTCC3’) and subcloned into the Gateway entry vector pDONR 221 (Invitrogen) by BP reaction and finally recombined into the destination vector pEarleyGate 201-nYFP and pEarleyGate 202-cYFP vector (Dai et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein bands were then detected with Alexa Fluor R 680 goat anti-rabbit IgG (Invitrogen, cat# A32734 ...
-
bioRxiv - Microbiology 2024Quote: HepG2-NTCP and PHH cells were seeded in type I collagen (R-011-K, Gibco)-coated plates ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell pellets were suspended in 10µl of the Neon transfection buffer R (ThermoFisher Scientific, MPK1096). Cells were transiently transfected with mito-GFP (Cox8A-EGFP ...
-
bioRxiv - Cancer Biology 2024Quote: ... KMT2A-r cell line SUP-T13 was cultured in suspension in RPMI (ATCC modification) (Gibco) with 10% FBS and penicillin 100 U/ml and streptomycin 100 μg/ml.
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 10% FBS (R&D, Cat# S11150H) and 1X Antibiotic-Antimycotic (ThermoFisher, Cat# 15240096). Jurkat cells were cultured in RPMI 1640 (ThermoFisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... The resulting gel was stained with Coomassie brilliant blue R-250 (#33445225GM, Thermo Fisher Scientific) then washed with a destaining solution (40% water ...
-
bioRxiv - Biochemistry 2024Quote: ... spun (15,000 g, 15 minutes, 4°C, Heraeus Multifuge 3S-R, Thermo Fisher Scientific, Germany), supernatants evaporated to complete dryness (21°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... with the Neon 100uL tip kit that includes the R buffer for electroporation (Thermo Fisher Sci). One million cells were resuspended in 100uL of R buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... Tissues were treated for 10 min R/T with proteinase K (10 µg/ml Ambion AM2546) and washed twice with 2× SSC (Ambion AM9765) ...
-
bioRxiv - Developmental Biology 2022Quote: ... via an L-R reaction with GATEWAY LR clonase II plus enzyme mix (12538120, Thermo Fisher). pBP-Gal80Uw-6 was designed to establish constructs carrying Gal80 under the control of regulatory cis-elements of interest (Pfeiffer et al. ...