Labshake search
Citations for Thermo Fisher :
801 - 850 of 10000+ citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Transient transfection was performed 24 hours after plating using Lipofectamine 2000 (Thermo Scientific) according to manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were then seeded into collagen coated 24 well plates (Thermo Fisher, A1142802) for 24 h before adding sorted cells ...
-
bioRxiv - Microbiology 2023Quote: ... siRNAs were transfected twice into cells 24 hours apart using Lipofectamine 3000 (Invitrogen) as per the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were transfected 24 hours later using lipofectamine 3000 (Thermo Fisher Scientific L3000008) with 1ug of plasmid NLS-Cas9-NLS and 0.5ug of appropriate Tol2-sgRNA -GFP plasmids ...
-
bioRxiv - Genetics 2024Quote: Cells grown in 24-well plates in DMEM supplemented with 10% FBS (Gibco) were seeded 24 hours before transfection ...
-
bioRxiv - Microbiology 2024Quote: ... and DNA was extracted using phenol:chloroform:isoamyl alcohol (25:24:1, Thermo Fisher Scientific). DNA was ethanol precipitated and fluorometrically quantified (Qubit ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a homogenizer (MP Biomedicals™ FastPrep-24, ThermoFisher Scientific, cat. no. 12079310). Samples were frozen overnight at -80 °C to allow further cell lysis ...
-
bioRxiv - Systems Biology 2023Quote: ... reverse transcribed with oligo(dT)24 (IDT) and Superscript III (Thermo Fisher, 18080044), and specific transcripts were measured by quantitative PCR as described previously68 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected 24 h later with plasmid DNA with Lipofectamine 2000 (Invitrogen). HEK cells were fixed in 4% PFA 24 h after transfection and washed three times with PBS ...
-
bioRxiv - Cell Biology 2023Quote: Cover glasses (No. 1.5, 24 x 60 mm) (Fisher Scientific, Hampton, NH, USA) were treated with Poly-D-lysine solution (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were plated on 24-well plates coated with poly-D-lysine (Gibco). Cells were grown in a humidified incubator held at 37°C and 10% CO2 ...
-
bioRxiv - Neuroscience 2023Quote: ... for 24 hours at room temperature and avidin-biotin-horseradish peroxidase (ThermoFisher Scientific) for 4 hours at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... siRNAs were forward-transfected 24 h prior to cell processing using RNAimax (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... DMEM was replaced with methionine and cysteine free DMEM (#21-013-24, Gibco), supplemented with 35S-labeled methionine and cysteine (#NEG772 ...
-
bioRxiv - Cell Biology 2023Quote: ... 24 and 48hpi by the addition of 500μL TrypLE Express (1×, ThermoFisher, #12605010), washed once using 1× PBS (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... 24 hours after induction media was exchanged to CO2 Independent Media (Gibco, 18045088) with 50nM siR- tubulin (Cytoskeleton ...
-
bioRxiv - Microbiology 2023Quote: ... After heating, 500 μL of phenol:chloroform:isoamyl Alcohol (25:24:1, v/v) (Invitrogen™ UltraPure™ - Fisher Scientific 15-593-031 ...
-
bioRxiv - Neuroscience 2023Quote: ... were transfected 18–24 h before odorant stimulation using Lipofectamine 2000 (11668019, Invitrogen) in MEM supplemented by 10% FBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected 24 hours after seeding using Lipofectamine™ 2000 (Thermo Fisher) at a 1:2 ratio (DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... Organoids were grown in 24 well plates (or 8-well chambered coverglass, Nunc LabTek II ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell-Matrigel mix was placed in 24-well plates (# 353047, Thermo Fisher Scientific) and incubated in cell culture incubator ...
-
bioRxiv - Immunology 2023Quote: ... 96 well Nunc culture or 24 well Nunc culture plates (Thermo Fisher Scientific) were coated with 10 µg/mL of anti-LAIR-1 agonist mAb (clone Dx26 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 83,000 cells/well were plated in a 24-well plate (Fisher Scientific) coated with Matrigel (Corning ...
-
bioRxiv - Neuroscience 2024Quote: ... were seeded on 24-well plate in StemPro-34 medium (Thermo Fisher Scientific) supplemented with SCF (100 ng/ml) ...
-
bioRxiv - Molecular Biology 2024Quote: ... transfection was performed 24 hours after plating using Lipofectamine 3000 transfection reagent (ThermoFisher) or LipoD293 (TEBU-Bio ...
-
bioRxiv - Molecular Biology 2024Quote: ... MDBK cells were plated onto 24-well cell culture plates (Thermo Fisher Scientific) at 1.28×104 cells per well ...
-
bioRxiv - Synthetic Biology 2024Quote: ... samples were passaged into tissue culture treated 24-well dishes (Fisher Scientific FB012929) 1 day prior to transfection ...
-
bioRxiv - Microbiology 2024Quote: ... 24 and 48 hpi RNA was extracted from cells using TRIzol (Invitrogen; 15596026). RNA was isolated and precipitated following the manufacturer’s instructions and 200ng was reverse transcribed into cDNA using the ABI cDNA synthesis kit (Applied Biosystems ...
-
bioRxiv - Neuroscience 2024Quote: ... and processed for 24 hrs at 4 degrees with NeuroTrace (1:500, Invitrogen) in PBS ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Activated T cells were seeded in a 24-well plate (10380932, Fisher Scientific ) with 1,5 ×106 T cells per ml per well ...
-
bioRxiv - Bioengineering 2024Quote: ... cells were activated for 24 hours by using CD3/CD28 Dynabeads (ThermoFisher, 11132D) at a ratio of 3:1 bead/cell and 20 IU of IL-2 (Preprotech ...
-
bioRxiv - Immunology 2024Quote: Mouse neutrophils were seeded at 105 in 24-well plates in RPMI (Gibco) containing penicillin/streptomycin (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 24 hours and then stored in 100% methanol (Fisher Scientific A412P-4).
-
bioRxiv - Developmental Biology 2024Quote: ... by spotting 45-μl droplets in 24-well plates (Thermo Fisher Scientific, 142475). Typically ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Developmental Biology 2024Quote: ... and passaged every 3–5 days after approximately 5 minutes of incubation with 0.5 mM EDTA (15575020, Life Technologies).
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and were supplemented with 10mM EdU (5-ethyl-2’-deoxyuridine) (ThermoFisher Scientific, Rockford, IL) during the final 6 hours of incubation to mark proliferating cells ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR was performed on QuantStudio 3 and 5 Real-Time PCR Systems (Thermo Fisher Scientific) based on the following cycling parameters ...
-
Potassium channel-driven bioelectric signaling regulates metastasis in triple-negative breast cancerbioRxiv - Cancer Biology 2021Quote: ... CDH11 #4: 5’-CCUUAUGACUCCAUUCAAA-3’ using Lipofectamine RNAiMAX transfection reagent (13778030; ThermoFisher Scientific, Waltham, MA) in serum-free DMEM ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 mM EDTA) and settled for 3 min in a magnetic stand (Fisher scientific, #FERMR02). Beads were then resuspended in 1 volume of IP buffer and ready to use ...
-
bioRxiv - Molecular Biology 2022Quote: ... Grids were blotted for 3 - 5 s in a Vitrobot (Mark IV, Thermo Fisher Scientific) at 20 °C and 100% humidity ...
-
bioRxiv - Cell Biology 2022Quote: Control siRNA against Luciferase (siLuc) was custom ordered from Life technologies (sense: 5’-uaugcaguugcucuccagcdtdt-3’). Individual or pooled siRNAs against other targets were ordered from Horizon Discovery (Dharmacon) ...
-
bioRxiv - Genetics 2021Quote: ... 3×105 U2OS cells were incubated with 5 pmol siRNA using lipofectamine RNAiMAX (Thermo Fisher) in a 12-well tissue culture plate for 2hr ...
-
bioRxiv - Genomics 2021Quote: ... Erythrocytes were lysed by treatment with 3-5 mL ACK lysing buffer (Gibco, Cat#A1049201) for 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... London) were transiently transfected with the following antisense oligos: ROD1 (5′ GGAAUGAUAUUGAGCUGCUAACAAA 3′; ThermoFisher Scientific), TACC3 (5’ GAGCGGACCUGUAAAACUA 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... 3-5 mm skin biopsies were collected in Biopsy Collection Medium (RPMI 1460 [Thermo Fisher] with 1X Antibiotic-Antimycotic [Thermo Fisher]) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Add pre-mix chewing solution (5 μl 10xNEBbuffer2.1, 3 μl 100 mM DTT (ThermoFisher, A39255), 2 μl 100 mM ATP (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... homogenized and placed in sterile 5 mL Eppendorf tubes containing 3 mL of RNAlater (ThermoFisher). The tubes were stored at -20°C upon our arrival in the laboratory ...
-
bioRxiv - Bioengineering 2024Quote: ... Red blood cells were lysed with ACK Lysing Buffer (Gibco, 3 ml for 5 min). The cells were counted and resuspended in RPMI-1640 medium (Corning ...