Labshake search
Citations for Thermo Fisher :
5851 - 5900 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 5×105 EPCAM+ cells in 200 μl CMM medium based on DMEM/F12 (Gibco, 11320033) supplemented with 1 mM L-glutamine (Life technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... digestion for 3 to 5 min at 37 °C and washed with Neurobasal medium (Invitrogen) supplemented with 2% B-27 (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: ... B-cells were cultured at 37 °C and 5% CO2 in 1640 RPMI (Life technologies) supplemented with 10% FCS (Biowest) ...
-
bioRxiv - Biochemistry 2023Quote: ... the coverslip was mounted on a glass slide using 5 μL SlowFade (Invitrogen Life Technologies) and the edges sealed with fingernail polish ...
-
bioRxiv - Biochemistry 2023Quote: ... the coverslip was mounted on a glass slide using 5 μL SlowFade (Invitrogen Life Technologies) and the edges sealed with fingernail polish ...
-
bioRxiv - Bioengineering 2022Quote: ... Real time qPCR was performed using the QuantStudio 5 Real-Time PCR system (Applied Biosystems) using a total reaction volume of 20 μL ...
-
bioRxiv - Biophysics 2023Quote: ... Cells were grown at 37°C under 5% CO2 in DMEM/F12 medium (11039047, Gibco), supplemented with 5% charcoal (C6241 ...
-
bioRxiv - Bioengineering 2022Quote: ... 100Å) with a C18 nano Viper trap-column (0.3 mm ×5 mm, Thermo Fisher Scientific) was used for peptide elution and separation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Real-time PCR was performed using the QuantStudio 5 Real-Time PCR System (Applied Biosystems) and the THUNDERBIRD NEXT SYBR qPCR Mix (TOYOBO) ...
-
bioRxiv - Molecular Biology 2023Quote: MCF10A cells were cultured in DMEM/F12 (Nacalai Tesque) supplemented with 5% horse serum (Gibco), 20 ng/ml EGF (PeproTech) ...
-
bioRxiv - Microbiology 2023Quote: ... Nuclei were counterstained by Hoechst 33342 (Thermo Fisher Scientific, 2 μg/mL, 5 min, RT), and slides were mounted in ProLong Gold antifade mountant (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... BM cells were incubated with MitoSOX Red (5 μM, Thermo Fisher Scientific, Cat. No. M36008) at 37 °C in PBS and then with appropriate BM progenitor or monocyte makers plus viability dye for 20 min at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... MRC-5 and HEK293-FT cells were grown in DMEM with GlutaMAX (Thermo Fisher # 10566016). CHO-K1 ...
-
bioRxiv - Microbiology 2022Quote: ... Biotin was detected using a streptavidin-conjugated AlexaFluor488 (5 μg/ml; Thermo Fisher Scientific; S11223). Virus and mock inoculations in non-enzymatic-treated cells were included as positive and negative infection controls ...
-
bioRxiv - Molecular Biology 2023Quote: ... and aqueous phase was precipitated with 1 volume of isopropanol and 5 ug Glycogen (Invitrogen) at -80 °C for 1 hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... or a combination of DNase I and 5 µg of RNase A (Thermo Scientific; EN0531). For the untreated BNE profile ...
-
bioRxiv - Immunology 2023Quote: ... The isolated cells were fluorescently labelled with 5 μM CellTrace Violet (C34571, Thermo Fisher Scientific) in PBS for 8 min at 37° C and washed twice in R10 media ...
-
bioRxiv - Biochemistry 2023Quote: In vitro transcribed RNA was 5’ dephosphorylated using FastAP™ thermosensitive alkaline phosphatase (Thermo Scientific) according to manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 5% FBS or at P7-8 in ice-cold Hibernate-A Medium (ThermoFisher, A1247501) with 10% FBS and B-27 Supplement (ThermoFisher ...
-
bioRxiv - Genomics 2023Quote: ... then resuspend in 5 mL blocking buffer with goat-anti-rabbit-647 (ThermoFisher A-21245) at 1:5,000 and DAPI at 1:100,000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sections were cut at 5 μm thickness and collected on Superfrost- plus slides (Fisher Scientific). E17.5 limbs were decalcified with EDTA at 4°C overnight before paraffin embedding.
-
bioRxiv - Immunology 2023Quote: ... or in 20 mL TBE + 5 uL of SYBR Green DNA Gel Stain (ThermoFisher Scientific). Gels were imaged on the BioRad Gel Doc imaging system.
-
bioRxiv - Biophysics 2023Quote: HeLa TDS cells were cultured at 37 °C and 5% CO2 in DMEM (Gibco, Invitrogen) supplemented with 10% FBS (Life Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µg of RNA was precleared with 25 µl of Protein G Dynabeads (Invitrogen, 10003D) for 30 min at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR was performed using the QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific), and the Ct values of Zcchc3 were normalized to the mean values obtained using ACTB as a housekeeping gene (ΔΔCt method).
-
bioRxiv - Molecular Biology 2023Quote: ... after a short incubation (30 minutes) with EU (5-ethynyl uridine, Thermo Fisher Scientific, E10342) and in the presence or absence of a MYC inhibitor (64 µM ...
-
bioRxiv - Immunology 2023Quote: ... 5% CO2 in CTS™ OpTmizer™ T-Cell Expansion SFM (ThermoFisher Scientific Cat# A1048501).
-
bioRxiv - Plant Biology 2023Quote: ... CP-R: 5’GGGGACCACTTTGTACAAGAAAGCTGGG TCCTGCACAGAACCTACTCC3’) and subcloned into the Gateway entry vector pDONR 221 (Invitrogen) by BP reaction and finally recombined into the destination vector pEarleyGate 201-nYFP and pEarleyGate 202-cYFP vector (Dai et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... The neurons were then washed 3 times for 5 minutes with 1X DPBS (14080055, Gibco) containing 0.1% Tween ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Bile canaliculi were observed with a live staining technique using 5-chloromethylfluorescein diacetate (CMFDA, Invitrogen). Immunofluorescent and brightfield images were taken using an inverted epifluorescence microscope (Zeiss).
-
bioRxiv - Cancer Biology 2023Quote: ... and NBL-W-S were grown at 5% CO2 in RPMI 1640 medium (Life Technologies) supplemented with 10% heat-inactivated FBS ...
-
bioRxiv - Bioengineering 2023Quote: ... which was immediately neutralized by adding 5 μl aliquots of 5M NaOH (Fisher Scientific, MA). Stem Cell Qualified ECM Gel (CC131-5ML ...
-
bioRxiv - Bioengineering 2023Quote: ... qRT-PCR plates were run using the QuantStudio 5 Real-Time PCR system (Applied Biosystems) with a total reaction volume of 20 µL ...
-
bioRxiv - Biophysics 2023Quote: ... the tissue was incubated for 5 min with 1 µM TO-PRO-3 iodide (Invitrogen, Life Technologies Corporation ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were subsequently incubated with the blocking solution (5% Skim Milk Powder (10651135, Fisher Scientific) added to tris-buffered saline (TBS ...
-
bioRxiv - Microbiology 2023Quote: ... 200 µl clarified lysate were combined with 5 µl RNase I (10 U/µl, Invitrogen). Reactions were incubated at RT for 45 min with shaking ...
-
bioRxiv - Molecular Biology 2023Quote: ... the cells were cultured in air with 5% CO2 at +37°C with DMEM (Gibco) containing 10% fetal bovine serum (BioWest) ...
-
bioRxiv - Microbiology 2023Quote: ... dried and mounted on microscopy glass slides with Prolong Diamond antifade 5 (Thermo Fisher Scientific). Slides were cured overnight at room temperature and imaged on a spinning disk Eclipse Ti2-E inverted microscope (Nikon) ...
-
bioRxiv - Neuroscience 2023Quote: ... hiPS cells were cultured on vitronectincoated plates (5 μg ml−1, Thermo Fisher Scientific, A14700) in Essential 8 medium with supplement (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... or 5 µg/ml mouse IgG2a kappa Isotype control (eBM2a) APC (Thermo Fisher Scientific, USA) as the isotype control ...
-
bioRxiv - Immunology 2023Quote: ... Cells were spun down at 400xg for 5 minutes and resuspended in LCK buffer (ThermoFisher) for 3 min to lyse red blood cells ...
-
bioRxiv - Microbiology 2023Quote: ... FungiQuant-Prb (6FAM) 5′-TGGTGCATGGCCGTT-3′ (MGBNFQ) 57 and QuantStudio3 instrument (Applied Biosystems, CA, USA). We used the following qPCR conditions ...
-
bioRxiv - Neuroscience 2023Quote: ... that was supplemented with heat-inactivated 10% FBS and 5% HS (Gibco, Billings, MT, USA), 2 mM L-glutamine (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and 5 μL of cell culture was plated onto 12-well plates (Thermo Fisher Scientific). Each well contained 1 mL LB agar supplemented with 2 mM IPTG ...
-
bioRxiv - Biochemistry 2022Quote: 5’ Biotinylated-dT32 was immobilized onto pre-equilibrated 20μl streptavidin coated magnetic beads (Thermo Scientific) at saturating concentrations before being washed with several 1ml volumes of wash buffer (50mM Tris-HCl ...
-
bioRxiv - Biochemistry 2023Quote: ... The IP samples were dephosphorylated on-bead by 5 U of FastAP (Thermo Scientific EF0615) in 100 μL slurry at 37 °C for 30 min in a thermomixer with 15 s pulse-shaking at 1200 r.p.m ...
-
bioRxiv - Biochemistry 2023Quote: ... 5-minute activation of HRP was done by development of ECL Clarity Max reagents (Invitrogen). Blots were imaged by chemilumines-cence (Biorad ChemiDoc) ...
-
bioRxiv - Biophysics 2023Quote: Cells were seeded onto 5 µg/ml laminin (BioLamina LN511) coated 8-chamber coverglass (Nunc™ Lab-Tek™ II Chambered Coverglass ...
-
bioRxiv - Bioengineering 2022Quote: ... Hydrogels were then labeled with primary 5-methylcytosine (recombinant rabbit monoclonal, ThermoFisher RM231, 1:200) antibody ...
-
bioRxiv - Biochemistry 2022Quote: ... samples were incubated with 5 µg anti-FLAG antibody bound to Protein G Dynabeads (Invitrogen).