Labshake search
Citations for Thermo Fisher :
5701 - 5750 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... a PepSwift trap is used pre-RP (200 μm x 5 mm, Thermo Scientific DX164558). Samples are eluted from the former with an injection of 10 μL acetonitrile and from the latter by an RP gradient ...
-
bioRxiv - Neuroscience 2020Quote: ... and split 1:5 on T25 flasks (Thermo-Fisher Scientific; Cat. No. 12-556-009) coated with poly-L-ornithine (PLO ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated for 5 minutes with nuclear counterstain Hoechst 33342 (1:1000 in PBS, ThermoFisher #H3570), rinsed 3 x 5 minutes in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteins were eluted from beads by boiling for 5 min in LDS sample buffer (ThermoFisher) and the eluates analyzed by Western blot as described above.
-
bioRxiv - Synthetic Biology 2021Quote: ... the samples were incubated at 56 °C for 1 hour with 5 mM dithiothreitol (ThermoFisher). Then ...
-
bioRxiv - Biophysics 2021Quote: ... K562 cells were cultured at 37 °C with 5% CO2 in DMEM with GlutaMAX (GIBCO) supplemented with 10% FBS and 1% penicillin-streptomycin for two days ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were grown at 37 °C and 5% CO2 in DMEM (Gibco, cat. no. 11965) with high glucose (4.5 g l-1 ...
-
bioRxiv - Biochemistry 2021Quote: ... at 37°C in RPMI 1640 medium supplemented with 5 g/L AlbuMAX II (Gibco), 2 g/L NaHCO3 (Fisher) ...
-
bioRxiv - Cell Biology 2019Quote: HEK293 cells were cultured under standard conditions (37°C, 5% CO2) in DMEM medium (Gibco) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 cells were maintained at 5% CO2 at 37°C in DMEM with glutamine (Invitrogen) supplemented with 10% FBS (Hyclone) ...
-
bioRxiv - Cell Biology 2021Quote: 5×103 C2C12 cells were cultured on a Nunc™ glass base dish (Thermo Scientific) coated with fibronectin and cultured overnight ...
-
bioRxiv - Cell Biology 2021Quote: For expression of proteins 5 ml of an overnight culture of BL21 DE3 AI (Invitrogen) E ...
-
bioRxiv - Genomics 2020Quote: ... and 30s at 60 °C in QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific). The sequences of the probes and primers are listed in supplementary table 2 ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated overnight (4° C) with 5 µg of Cx36 (Thermofisher, 37-4600, RRID: AB_2533320) or NMDAR1 (Thermofisher ...
-
bioRxiv - Microbiology 2020Quote: ... 5-10 ul of each sample was loaded on 4-12% Bis-Tris gels (Thermofisher).
-
bioRxiv - Immunology 2021Quote: ... or L9.6 T cells were stained with 1-5 μM of CTV or CFSE (Invitrogen) according to the manufacturer’s protocol.
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.1 μL Platinum Taq DNA Polymerase High Fidelity (5 U/μL) (Invitrogen, Carlsbad, CA, USA), and 1.0 μL template cDNA ...
-
bioRxiv - Immunology 2021Quote: ... THP-1 monocytes were cultured during 5 days in RPMI-1640 Medium (Gibco, MD, USA); 2-mercaptoethanol (0.05 mM final concentration ...
-
bioRxiv - Molecular Biology 2021Quote: ... on 35 mm dishes (37 °C, 5 % CO2) coated with Geltrex□ (Gibco, Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... on 35 mm dishes (37 °C, 5 % CO2) coated with Geltrex□ (Gibco, Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5-aminoimidazole-4-carboxamide-1-β-D-ribofuranoside in DMSO (0.1-1mM, AICAR, Fisher Scientific), or isoproterenol (5-25µM ...
-
bioRxiv - Molecular Biology 2021Quote: ... Differentiated organoids were broken using a 5-minute incubation with TrypLE (TrypLE Express; Life Technologies). After shearing ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5% Triton X-100 and 5 mM dithiothreitol (DTT) supplemented with Ribolock (Thermo Fisher Scientific) and proteinase inhibitor cocktail (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... VERO cells were overlaid with 0.8% agarose in DMEM medium containing 5% FBS (Invitrogen, CA) and incubated at 37°C for three days ...
-
bioRxiv - Immunology 2021Quote: ... Prepare for biotin pull-down by washing 5 μl of Streptavidin C-1 (Invitrogen, 65001) beads with Tween Wash Buffer (5 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Microbiology 2021Quote: ... and 4 mg/l 5-(and-6)-carboxyfluorescein and succinimidyl ester (FITC; Thermo Fisher Scientific), respectively ...
-
bioRxiv - Immunology 2020Quote: ... After this 1⨯10 5 BMDC per condition were cultured on a collagen (Fisher Scientific) coated6-well plate (Corning ...
-
bioRxiv - Immunology 2020Quote: ... macrophages and synovial fibroblasts were labelled with CellTrace™-Far Red (5 μM, Life Technologies) and CellTrace™-Violet (5 μM ...
-
bioRxiv - Microbiology 2020Quote: ... diluted in water 70:30 (Optima LC/MS Grade Water, 7732-18-5, Fisher Scientific) was added ...
-
bioRxiv - Neuroscience 2021Quote: ... Cultured neurons were maintained in a 5% CO2 humidified incubator in Neurobasal-A medium (Invitrogen) containing 1.25% fetal bovine serum (FBS ...
-
bioRxiv - Genomics 2021Quote: ... Erythrocytes were lysed by treatment with 3-5 mL ACK lysing buffer (Gibco, Cat#A1049201) for 5 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... BMSCs were cultured at 37°C and 5% CO2 with DMEM/F12 medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... London) were transiently transfected with the following antisense oligos: ROD1 (5′ GGAAUGAUAUUGAGCUGCUAACAAA 3′; ThermoFisher Scientific), TACC3 (5’ GAGCGGACCUGUAAAACUA 3’ ...
-
bioRxiv - Immunology 2022Quote: ... 5 μL of chromatin was measured using the Qubit dsDNA HS Assay Kit (Invitrogen, Q32851).
-
bioRxiv - Microbiology 2022Quote: ... 5 µL of fixed sample were stained with 195 µL SYBR gold (Invitrogen, Paisley, UK) prepared in Tris-EDTA buffer as instructed by the manufacturer (5 μL SYBR gold in 50 mL Tris-EDTA) ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 stocks of rRRV-HuNoV-VP1 with Trizol Reagent (Thermo Fisher Scientific, cat. #15596018) according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... Animals were injected intraperitoneally with 40 mg/kg EdU (5-ethynyl-2’-deoxyuridine; Invitrogen, E10187) before the session ...
-
Activation of innate immune cGAS-STING pathway contributes to Alzheimer’s pathogenesis in 5×FAD micebioRxiv - Neuroscience 2022Quote: ... Slides were counterstained with 5 μg/mL 4’,6-diamidino-2-phenylindole (DAPI; ThermoFisher Scientific) for 10 min at room temperature and washed with 1 × PBST (0.2% Triton-X 100 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The isolated kidneys were placed in 5 ml Hanks and 25 ul LysoTracker Red (Invitrogen) and cultured at 37° C for 30 minutes ...
-
bioRxiv - Physiology 2022Quote: ... Reactions were run in duplicate on a Quantstudio 5 384-well PCR machine (Thermo Fisher Scientific Life Sciences ...
-
bioRxiv - Cell Biology 2022Quote: ... boiled 5 min at 95 °C in 80 μl NuPAGE LDS Sample Buffer (Invitrogen, #NP0007) and dithiothreitol ...
-
bioRxiv - Cancer Biology 2022Quote: ... To quantify mitochondrial ROS cells were incubated with 5 μM MitoSOX Red (Thermo Fisher, M36008). After 30 minutes of staining ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 μL of sample were injected by a Vanquish Split Sampler HT autosampler (Thermo Scientific), while the autosampler temperature was kept at 4 °C ...
-
bioRxiv - Biophysics 2022Quote: ... 5 µL of chromatin was measured using the Qubit dsDNA HS Assay Kit (Invitrogen, Q32851). To ensure similar chromatin concentrations and match IP conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... These cells were incubated at 37°C in 5% CO2 and passaged with trypsin (Gibco) 2–3 times per week to ensure that they never reached confluency.
-
bioRxiv - Cell Biology 2022Quote: ... These cells were incubated at 37°C in 5% CO2 and passaged with trypsin (Gibco) every 72 hours to ensure that they never reached confluency.
-
bioRxiv - Cancer Biology 2022Quote: ... All antibodies used were dissolved in 5% albumine bovine fraction V (Thermo Scientific, pH 7.0) in TBS-T.
-
bioRxiv - Genomics 2022Quote: ... media was changed to 1:1 KSR: N2B media with puromycin (5 ug/ml, Gibco). Puromycin was maintained in the media throughout the differentiation ...
-
bioRxiv - Immunology 2022Quote: ... and incubated overnight at 37 °C and 5% CO2 in R10 without phenol red (Gibco). The following day ...
-
bioRxiv - Developmental Biology 2022Quote: ... The right ventricle was perfused with 5-10 mL of cold PBS (Gibco, 10010-023) to clear blood from the lungs ...