Labshake search
Citations for Thermo Fisher :
6001 - 6050 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 2mM Glutamax and 5% Pen/Strep was used (all items purchased from Thermo Fisher Scientific). At DIV13 ...
-
bioRxiv - Neuroscience 2024Quote: ... and cultured at 37°C with 5% CO2 in minimal essential medium (MEM, Gibco, #11380037) supplemented with glucose (4.5 g/L) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 µL of 1 mg/mL Escherichia coli Bioparticles AlexaFluor-594 conjugate (ThermoFisher cat# E23370) were injected directly below the sealed wound at 3 dpi using a Hamilton syringe while fish were anesthetized ...
-
bioRxiv - Bioengineering 2024Quote: ... GAPDH reverse: 5′-AAG TGG TCG TTG AGG GCA ATG -3′ (Invitrogen, Thermo Fisher Scientific); ALIX forward ...
-
bioRxiv - Bioengineering 2024Quote: ... GAPDH reverse: 5′-AAG TGG TCG TTG AGG GCA ATG -3′ (Invitrogen, Thermo Fisher Scientific); ALIX forward ...
-
bioRxiv - Neuroscience 2024Quote: ... 3-5 μL of a heavy-weight dextran (Invitrogen, Cat#D1818, 70,000 MW, lysine fixable) was injected into each juvenile octopus and allowed to circulate throughout the body for 5 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... MCF10A-5E cells70 were cultured in DMEM/F12 supplemented with 5% horse serum (Invitrogen,16050122), 20 ng/mL EGF (Peprotech ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by 30 minutes with streptavidin-PE (5 µg/mL, Thermo Scientific #12-4317-87). Results were read on a Luminex xMAP Intelliflex system.
-
bioRxiv - Cancer Biology 2024Quote: ... PVDF membranes were blocked for 1 hour in 5% Bovine Serum Albumin (BSA) (Fisher Scientific) dissolved in 1X Tris-Buffered Saline with 0.01% Triton-X-100 (TBST ...
-
bioRxiv - Immunology 2024Quote: ... and incubated for 5 minutes at 37°C with 1 mL room temperature Accutase (Gibco) to detach the cells from the plate ...
-
Tumor microenvironment acidosis favors pancreatic cancer stem cell properties and in vivo metastasisbioRxiv - Cancer Biology 2024Quote: ... and the cells resuspended in 3-5 mL of pancreatosphere medium (DMEM/F12 (Gibco, #11320033), 1% P/S ...
-
bioRxiv - Cell Biology 2024Quote: ... U2OS cells were cultured at 37°C in 5% CO2 using DMEM (Gibco, 41965-062) supplemented with 10% heat-inactivated Tet-free fetal bovine serum and 1% penicillin/streptomycin (Gibco 15070063) ...
-
bioRxiv - Immunology 2024Quote: ... Vybrant CFDA SE Cell Tracer Kit-Carboxyfluorescein diacetate succinimidyl ester (CFSE) (Invitrogen, V12883, 5 µM); CellTrace Violet (CTV ...
-
bioRxiv - Immunology 2024Quote: ... frozen in 5 × 106 cells/ml aliquots in 90% FBS/10% DMSO (Thermo Fisher Scientific) and stored at –80°C prior to being shipped on dry ice to New York ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated with 5 µM of Cell Trace Violet Cell Proliferation Kit (C34557; ThermoFisher), incubated for 10 minutes at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... senescent CD4+ T cells were treated with BrdU (5-bromo-2′-deoxyuridine; 10µM; B23151-ThermoFisher) for 72 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM MgCl2) using ZebaTM Spin Desalting Column with a 7k MWCO (Thermo Fisher Scientific). A serial dilution of the protein samples was prepared in a black 384-well non-binding microplate (Greiner Bio-One ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were stained with Vybrant™ DyeCycle™ Green Stain (5 µM, V35004, Thermo Fisher) after completing the Cell Mito Stress Test or Glycolysis Stress Test ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM imidazole) and incubated with 500 µl Ni-NTA beads (Thermo Fisher Scientific, 88831) at 4 °C for 2 h ...
-
bioRxiv - Microbiology 2024Quote: ... with 5 μg of total RNA from each sample and random primers (Invitro Life Technologies). cDNA was subsequently purified with the MinElute PCR Purification Kit (Qiagen) ...
-
bioRxiv - Immunology 2024Quote: ... RT-PCR was run on a QuantStudio 5 Real-Time PCR system (Thermo Fisher Scientific) using the Maxima SYBR Green/ROX qPCR Master Mix (2X ...
-
bioRxiv - Cancer Biology 2024Quote: ... Treated cells were then counterstained with DAPI for 5 minutes and ActinGreen 488 (Thermofisher, R37110) for 20 minutes at RT ...
-
bioRxiv - Microbiology 2024Quote: ... Tol 5 whole genome database (AP024708, AP024709; NCBI) were performed using SEQUEST (Thermo Fisher Scientific). The search parameters were set as follows ...
-
bioRxiv - Microbiology 2024Quote: ... and/or blood agar (BA, tryptic soy agar with 5% sheep blood, Thermo Fisher Scientific). Note that both PTA and BA plates contain heme precursors ...
-
bioRxiv - Microbiology 2024Quote: ... parasites were rinsed in PBSTx then permeablized in 5 μg/ml proteinase K (Ambion AM2546). Following proteinase K treatment ...
-
bioRxiv - Microbiology 2020Quote: ... A two-step qRT-PCR reaction in triplicate was performed on a Quantstudio 5 (Applied Biosystems). Reverse transcription was carried out with the Superscript III RT first strand synthesis kit (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... T cells were maintained at 37°C and 5% CO2 in RPMI 1640 media (Life technologies) supplemented with 10% FBS (MERCK) ...
-
bioRxiv - Biophysics 2021Quote: ... about ~5 μg of bacmid were transfected using 6 μl of CellfectinII reagent (Thermo Fisher Scientific). 5 days after initial transfection ...
-
bioRxiv - Genetics 2021Quote: ... In vitro transcription of 5’ capped mRNAs was performed using the mMACHINE SP6 Transcription Kit (Ambion) following manufacturer’s protocol and as previously described in (33 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Peptides were loaded onto the trapping column (PepMap100, C18, 300 µm x 5 mm, Thermo Scientific) using partial loop injection with 2% acetonitrile (ACN) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 20 mM Sodium Citrate (pH 5 at 25°C) and 0.2 U/µl RNase T1 (ThermoFisher). Reaction mixtures were incubated at 50°C for 10 min prior to being stopped by flash freezing in liquid nitrogen for 5 min and adding equivolume 90% formamide ...
-
bioRxiv - Systems Biology 2020Quote: ... Disulfide bonds were reduced with 5 mM Tris(2-carboxyethyl)phosphine (TCEP) Bond-breaker (Thermo Scientific) at RT for 1 hr ...
-
bioRxiv - Systems Biology 2020Quote: ... cells were incubated with 5 μg/mL HRP conjugated goat-anti-rabbit (Thermo Fisher Scientific; A16110) in 1% (wt/vol ...
-
bioRxiv - Cell Biology 2020Quote: ... protected by an Acclaim PepMap C18 column (100 μm x 2 cm, 5 μm; Thermo Scientific) before injection into a Q-Exactive mass spectrometer (ThermoFisher) ...
-
bioRxiv - Cell Biology 2020Quote: Mitochondrial ROS was detected by incubating cells with 5 μM Mito-Sox Red (Invitrogen, Carlsbad, CA) for 10 min at 37 C and measuring fluorescence using a microplate reader.
-
bioRxiv - Cell Biology 2020Quote: ... using 5 μl/ml Lipofectamine RNAiMAX diluted in Opti-MEM I Reduced Serum Medium (Life Technologies). The cultures were analysed on day 6 of differentiation.
-
bioRxiv - Cell Biology 2020Quote: ... A375 cells were cultured at 37 °C with 5% CO2 in DMEM (Thermo Fisher, #12800-082) supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were incubated with anti-cytochrome C (33-8200, 5 μg/ml, mouse monoclonal, Thermo Fisher) and anti-SPIRE1 (SA-2133 ...
-
bioRxiv - Cell Biology 2019Quote: Cells were incubated at 37°C and 5% CO2 with MitoTracker-Red FM (100 nM) (Invitrogen) for 15 min to stain mitochondria and Hoechst 33258 (2.5 mg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... adapter-ligated template was digested with 5 U of AmpErase Uracil N-Glycosylase (Life Technologies, N8080096). Libraries were then PCR amplified and indexed using Phusion Hot Start II High Fidelity Polymerase (Thermo Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ATCC HeLa CCL2 (ATCC) were cultured at 37°C and 5% CO2 in DMEM (Gibco 11965092) supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... cells were detached with 5 mM EDTA and incubated with SYTOX™ Green (S7020, ThermoFisher Scientific) at 1/8000 dilution ...
-
bioRxiv - Developmental Biology 2021Quote: Treated and control 5 dpf larvae were submerged in 5mM MitoSOX ROS probe (Invitrogen, Carlsbad, CA) for 20 minutes at 28°C in the dark ...
-
bioRxiv - Developmental Biology 2021Quote: 5 ×104 ES cells were attached to gelatin coated glass slides by using cytospin (Thermo Scientific). Cells were fixed in 4% para-formaldehyde for 10 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2μl of annealing mix (5% ERCC RNA spike-In Mix (pre-diluted at 1:25,000; Invitrogen), 5% Oligo-dT (5⍰–AAGCAGTGGTATCAACGCAGAGTACT30VN-3⍰ ...
-
bioRxiv - Microbiology 2020Quote: ... The precolumn was a 2 cm EASYcolumn (ID 100 µm, 5 µm particles) (Thermo Fisher Scientific) while the analytical column was a 10 cm EASY-column (ID 75 µm ...
-
bioRxiv - Microbiology 2021Quote: BSRT7/5 cells at 90% confluence in 48-well dishes were transfected using Lipofectamine 2000 (Invitrogen) with a plasmid mixture containing 0.125 μg of pGaussia/Firefly minigenome ...
-
bioRxiv - Microbiology 2021Quote: ... samples of live culture were stained with 5 µM of the DNA-binding dye SYTO9 (Invitrogen), which emits green fluorescence when bound to DNA ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-sense, 5’ AAGAGGUUUAGCUGGUAC CTT 3’) or control nontargeting siRNA (Genepharma, Shanghai) using Lipofectamine RNAiMAX (Invitrogen). Six hours after transfection ...
-
bioRxiv - Microbiology 2020Quote: ... and in the presence of 5 μg ml-1 of erythromycin (Acros Organics, New Jersey, USA). The strain was preserved as a glycerol stock at −80° C.