Labshake search
Citations for Thermo Fisher :
5051 - 5100 of 10000+ citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... using 7-AAD (ThermoFisher Scientific) as a dead stain.
-
bioRxiv - Developmental Biology 2023Quote: ... using 7-AAD (ThermoFisher Scientific) as a dead cell stain ...
-
bioRxiv - Bioengineering 2024Quote: ... 7 kDa MWCO (Thermo Scientific). The extent of biotinylation was measured using the QuantTag Biotin Quantification kit (Vector Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... or DiD (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate, aka DiIC18(5)) (Thermo Fisher #D307) at a final concentration of 4 μg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed 3 times in 5% Bovine Serum Albumin (BSA; ThermoFisher Scientific, 11423164) in PBS then incubated with primary antibody to H2AX (Ser139) ...
-
bioRxiv - Genomics 2019Quote: ... using TVN PCR reverse primer (5’-CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTVN-3’) and SuperScript III Reverse Transcriptase (Invitrogen), and then the reaction was stopped by heating at 70°C for 15min ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 min each) and digested for 5 min with proteinase K (10μg/mL; Ambion). Tissue sections were allowed to hybridize overnight in a humid chamber at 65°C with 1 ng/µL of sense (negative probe ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg mtDNA were digested with 3 ul DraI Fastdigest restriction enzyme (Thermo Scientific) at 37°C for 3h and extracted with 1 volume phenol-chloroform ...
-
bioRxiv - Microbiology 2022Quote: ... FAM-5=CAT CCA ATC AAA GAC ATT GCG A 3=-TAMRA (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were washed 3 × 5 min and mounted on slides using Prolong Gold (Invitrogen). Deconvolution wide-field microscopy was performed using the DeltaVision Elite system equipped with an NA 1.42 60x PlanApo objective (Olympus ...
-
bioRxiv - Developmental Biology 2022Quote: ... zLL 5’- and 3’- RACE PCRs were performed using the GeneRacer core kit (Invitrogen). Total RNA (2 µg ...
-
bioRxiv - Cell Biology 2022Quote: ... CCDC66 was depleted using an siRNA with the sequence 5′-CAGTGTAATCAGTTCACAAtt-3′ (Thermo Scientific). Silencer Select Negative Control No ...
-
bioRxiv - Cell Biology 2024Quote: ... si-PRELID1: 5’-CCCGAAUCCCUAUAGCAAA-3’) were transfected using Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778075). Assays were normally carried out 48 h after transfection ...
-
bioRxiv - Genomics 2024Quote: ... and a QuantStudio 3 or QuantStudio 5 Real-Time PCR instrument (Applied Biosystems™). Primers used for qPCR are listed in Suppl ...
-
bioRxiv - Immunology 2024Quote: ... tonsils were rinsed 3 x 5 minutes with 1X PBS (10010023, ThermoFisher Scientific, USA) without agitation ...
-
bioRxiv - Cell Biology 2023Quote: ... The following siRNA target sequences were used: GTPBP5 siRNA: 5’-CGGUGGACACGUCAUUCUGTT-3’ (134621, Ambion); GTPBP7 siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... CCDC15 was depleted using an siRNA with sequence 5′-GCAGUACCUGAGACAUAGAtt-3′ (Ambion, Cat. # s36888). For depletion of POC5 ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-5 days as necessary using 0.5mM EDTA (Thermo Fisher). All staining and qPCR experiments included in Figure 1 were carried out in H1 and H9 stem cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5’ TCTTGCGGCTTTGTTGACAC 3’) using SYBR™ Green PCR Master Mix (Applied Biosystems, Bedford, MA). The quantities measured by real-time PCR were normalized to the Rpl13 (5’GGCGGACCGATTCAATAAGGTTCTGATCATTG 3’ ...
-
bioRxiv - Immunology 2020Quote: ... pH 8 (Ambion) for qPCR ...
-
bioRxiv - Neuroscience 2022Quote: ... 8% FBS (GIBCO), 100 mM Taurine (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... pH=8 (ThermoFisher, MA ...
-
bioRxiv - Systems Biology 2024Quote: ... pH 8 (Invitrogen, 1 M Tris pH 8.0 ...
-
bioRxiv - Systems Biology 2024Quote: ... pH 8 (Invitrogen, 1 M Tris pH 8.0 ...
-
bioRxiv - Systems Biology 2024Quote: ... pH 8 (Invitrogen, 1 M Tris pH 8.0 ...
-
bioRxiv - Systems Biology 2024Quote: ... pH 8 (Invitrogen, 1 M Tris pH 8.0 ...
-
bioRxiv - Biochemistry 2021Quote: ... Stained ovaries were finally mounted with one drop of vectashield in epoxy diagnostic slides (Thermo-Fisher Scientific, 3 wells 14 mm) and covered with high precision cover glasses ...
-
bioRxiv - Microbiology 2024Quote: ... isolated RNA was run using a TaqMan Fast Virus One-Step Master Mix (applied Biosystems) on a QuantStudio 3 Flex Real-Time PCR system (Applied Biosystems). RNA standards with known copy numbers were used to generate a standard curve and calculate sample copy numbers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and shRNA plasmids or pCDH plasmids by PEI-40000 with the ratio of 5: 1: 5 in opti-MEM (Gibco, Thermo Fisher Scientific). Virions were collected after 48 h after transfection ...
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with protease inhibitors (1 mM PMSF, 5 μg/ml aprotinin and 5 μg/ml leupeptin, #78443, Thermo Fisher Scientific, Waltham, MA). Fifty ul of Dynabeads Protein A/Protein G (#10015D ...
-
bioRxiv - Cell Biology 2020Quote: ... organoids (after 1 week of culture) were incubated (37°C, 5% CO2, 1 h) with 10 µM EdU (5-ethynyl-2’-deoxyuridine, Thermo Fisher Scientific), a nucleoside analog of thymidine incorporated into DNA during active DNA synthesis ...
-
bioRxiv - Molecular Biology 2022Quote: ... and incubating at 37°C in a 5% CO2 humidified incubator in DFGM supplemented with 5 ng mL−1 TGF-β1 (Thermo Fisher Scientific) and 100 μg mL−1 ascorbic acid ...
-
bioRxiv - Microbiology 2024Quote: ... each culture was diluted 1:1000 in BHI + 5% yeast and 10μl were streaked on a BHI + 5% yeast agar (Thermo Fisher Scientific, CM1136) plate ...
-
bioRxiv - Immunology 2024Quote: Analysis of cytokines and chemokines from sera and lungs homogenates collected 5 dpi and 5 dpc were conducted using the ProcartaPlex TM Mouse Cytokine & Chemokine Convenience Panel 1 26-plex (Thermo Fisher Scientific) following the manufacturer’s specifications ...
-
bioRxiv - Systems Biology 2023Quote: ... Cells were again washed 3x with 1 mL DPBS for 5 min each followed by nuclear labeling for 5 min with 1 mL 300 nM DAPI dissolved in DPBS (Thermo Fisher Scientific) and a 5-min DPBS wash ...
-
bioRxiv - Physiology 2020Quote: ... interleukin 6 (IL-6; Invitrogen, Carlsbad, CA), plasminogen activator inhibitor 1 (PAI-1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 500 µL of Herpes solution and 2.5 mL of 100 mM CaCl2), staining with Annexin V PE (BD Pharmagen™, BD Biosciences, CA, US and 1 mM 7-Aminoactiomycin D (Thermo Fisher Scientific) and analysis by Flow Cytometry using a BD LSRFortessa X20.
-
bioRxiv - Cell Biology 2022Quote: ... and using the Applied Biosystems ViiA 7 Real-Time PCR System and the appropriate primers for Taqman assays (Life Technologies; Supplementary Table 1). The relative gene expression was calculated using the 2-ΔΔCt quantification method after normalization to GAPDH values and expressed as fold of levels found in undifferentiated hPSCs cells for cultured cell or in WT mice group for liver analysis.
-
bioRxiv - Immunology 2024Quote: ... then collected and plated 10:1 with allogeneic DC-10s in 24-well plates at a concentration of 7 × 105 to 1 × 106 T cells/mL in T cell media with 10 U/mL rhIL-10 (Gibco, Thermo Fisher Scientific). For CRISPRa experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... Equal amounts of RNA were reverse transcribed and amplified using TaqMan™ RNA-to-C T ™ 1-Step Kit kit on the ViiA 7 Real-Time PCR System (Applied Biosystems). TaqMan gene expression assay probes (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we added all four nucleotides at a final concentration of 1 µM (Biotin-7-dATP, Jena Biosciences, and dC-Atto647N or dU-Atto488, Jena Biosciences with respective pair of unmodified nucleotides, Thermo Scientific): [Biotin-7-dATP ...
-
bioRxiv - Cancer Biology 2024Quote: ... referred to as ENAS medium (supplementary table 1) PDTs were routinely passaged at intervals of 7 days using TrypLE (Gibco, Cat. No. 12605010) and pipetting to dissociate the cells.
-
bioRxiv - Cell Biology 2020Quote: ... Tissue was then transferred to 1% fibronectin-coated chambered slides (μ-Slide 8 Well Glass Bottom, Ibidi #80827, for live imaging; Nunc™ Lab-Tek™ II Chamber Slide with removable wells ...
-
bioRxiv - Molecular Biology 2019Quote: ... pombe cells were mixed in an 8:1 ratio and total RNA was extracted using the RiboPure yeast kit (Ambion, Life Technologies) using the following volumes ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were harvested before the cultures reached OD600 = 1 and were labeled with 8 mg/ml EZ-Link Sulfo-NHS-LC-biotin (ThermoFisher Scientific) for 30 minutes at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... cells were washed once with PBS (pH 8) and incubated with 1 mg/ml of EZ-link Sulfo-NHS-biotin (Thermo Fisher) in PBS (pH 8 ...
-
bioRxiv - Genetics 2022Quote: ... or one of five Hsa21 genes (100 ng/well; 1 row, 8 wells or technical replicates per unique cDNA) using Lipofectamine 2000 (Invitrogen, 11668030) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... which were then blotted for approximately 8 s and immediately plunged in 1:2 ethane:propane (Carbagas) at liquid nitrogen temperature using a Vitrobot (Thermo Fisher Scientific). The Vitrobot chamber was kept at 4 °C and 100% humidity during the whole procedure.
-
bioRxiv - Microbiology 2020Quote: ... The pH was adjusted to pH 8-8.5 with 1 M NaHCO3 and 50 µg of Alexa Fluor 488 NHS Ester (Thermo Fisher Scientific) was added ...