Labshake search
Citations for Bio-Rad :
3501 - 3550 of 7302 citations for Superoxide Anion Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... IL-17A titres in human serum samples were quantified using a multiplex cytokine panel (Bio-Plex Pro Human Cytokine Assay, BioRad) and a LuminexCorp Luminex 100 machine as per the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... Protein concentration was used as a reference for the samples and was measured by Bradford protein assay from Bio-Rad.
-
bioRxiv - Biochemistry 2023Quote: ... the total protein concentration was determined by Bradford assay using the Quick Start Bradford 1x Dye reagent (#5000205, Bio-Rad) and BSA (#23209 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lysates were cleared by centrifugation at 14,000 g for 15 min at 4°C and protein concentration was determined using the Bradford assay (Bio-Rad). Sodium dodecyl sulfate (SDS ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasma vitamin B12 concentrations were assessed using the BioRad Quantaphase II radio assay (Hercules, CA, USA;74. Plasma folate concentrations were also measured using the BioRad Quantaphase II radio assay (Hercules ...
-
bioRxiv - Cancer Biology 2022Quote: ... The reaction for ddPCR Copy Number Variation Assay was set up in 20 μl sample volume containing 10 μl of 2X ddPCR Supermix (no dUTP, BioRad), 1 μl of FAM-labeled target primers/probe (BioRad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein concentrations of the cellular extracts were determined using the DC Protein Assay (ref 5000112, Bio-Rad, Hercules, California, USA). Equal amounts of proteins (20 μg ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were diluted 50x and the ratio between mitochondrial and nuclear DNA was determined using a custom Taqman based assay and qPCR using a CFX Opus 384 quantitative PCR machine (Biorad). Relative mtDNA abundance was determine using the ΔΔCt method.
-
bioRxiv - Neuroscience 2023Quote: ... Microglia were counted using trypan blue (live-dead assay) on an automated cell counter (TC20 Automated Cell counter, Biorad, 508BR08836).
-
bioRxiv - Cell Biology 2023Quote: ... Protein concentration in the conditioned media and lysates were determined by DC protein assay (Bio-Rad, Hercules CA, 500-011).
-
bioRxiv - Biochemistry 2023Quote: ... The lysates were pelleted at 10,000 g for 10 min and the supernatants were used to determine the protein concentration using Bradford assay (Bio-Rad). After a preclearing step with Protein G Sepharose (Sigma) ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
Effects of menopause and high fat diet on metabolic outcomes in a mouse model of Alzheimer’s diseasebioRxiv - Neuroscience 2023Quote: ... Diabetes-associated markers were assessed using the Bio-Plex Pro Mouse Diabetes 8-Plex Assay (171F7001M; Bio-Rad, Carlsbad, California) according to the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2023Quote: ... and sample aliquots were diluted 1:50 in water before Bradford protein assay (Bio-Rad, Hercules, CA, USA, Cat# 5000006). Samples were normalized to 1 mg/mL in 0.1% Azo ...
-
bioRxiv - Genetics 2023Quote: ... The supernatant was transferred to a fresh 1.5 ml Eppendorf tube and protein concentration was measured using Bradford assay (Bio-Rad Protein assay Dye reagent Concentrate (#5000006 ...
-
bioRxiv - Cell Biology 2023Quote: ... TAG content was normalized to total protein determined using a standard Bradford Protein assay (Bio-Rad Laboratories, Hercules, CA, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... was followed to assay for a unique sequence in IL-12mRNA using the CFX96 Real-Time System (C1000 Thermocycler, BioRad).
-
bioRxiv - Cancer Biology 2023Quote: ... The pellet was resuspended into mitochondrial isolation buffer and for protein concentration test with DC protein assay (Bio-Rad, 5000111). The obtained mitochondria were aliquoted to 1.5 ml Eppendorf tube with 100 ug per tube and centrifuged at 9000 g for 10 min ...
-
bioRxiv - Cell Biology 2023Quote: The protein concentrations of the cell lysates were determined using a Bio-Rad Protein Assay Dye Reagent (Bio-Rad, 5000006). Volumes of lysates containing the same amount of total protein were heated to 95°C for 5 minutes after addition of 1/4 volume of 4x SDS-PAGE Loading Solution (250 mM Tris ...
-
bioRxiv - Plant Biology 2023Quote: ... A quantitative real-time PCR (RT-qPCR) assay was performed on a LightCycler 480 II system using 2x SYBR Green qPCR master mix (BioRad). Maize GAPDH (Zm00001eb233140 ...
-
bioRxiv - Biochemistry 2024Quote: ... Cholesterol values were calculated using known cholesterol solutions and normalized to protein content as measured by DC assay (Bio-Rad).
-
bioRxiv - Neuroscience 2024Quote: ... The resulting supernatant was transferred to a clean tube and protein concentration was determined using a Bradford assay (Bio-Rad). 200 μg tissue homogenate or 10 μg cell lysate was diluted in 50 μl CB lysis buffer and was used for the reaction with CatB Substrate (RR-amino-4-trifluoromethyl coumarin (AFC)).
-
bioRxiv - Cell Biology 2024Quote: ... The reaction mixture was prepared using a custom ddPCR assay (#10031276 for FAM and #10031279 for HEX; Bio-Rad Laboratories) and ddPCR Supermix for Probes (no dUTP ...
-
bioRxiv - Plant Biology 2024Quote: ... All RT-qPCR assays were performed on CFX™ Real-Time PCR Detection System (Bio-Rad, Inc., Hercules, CA, USA) instruments equipped with either 96-or 384-well blocks using the following program ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cell extracts were cleared at 5000g for 5min at 4°C and protein concentration was quantified by the Bradford assay (BioRad). Finally ...
-
bioRxiv - Immunology 2023Quote: ... The second kit used was the Bio-Plex Pro Serology Reagent Kit (Bio-Rad, Cat No. 12014777), with human IgA positive and negative controls (Bio-Rad ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The culture supernatant was obtained by centrifugation and used with the Bio-Plex Pro Human Cytokine 8-plex Assay (Bio-rad) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tumor samples were homogenized in RIPA buffer (Thermo, #89901) followed by protein concentration measurement using DC Protein Assay (Bio-Rad, #5000112). Tumor lysates were immunoblotted as above ...
-
bioRxiv - Cell Biology 2020Quote: ... Concentration of total cellular protein was measured according to the DC™ protein assay according to the manufacturer’s instruction (BIO-RAD).
-
bioRxiv - Microbiology 2020Quote: ... and the total protein concentration of the samples was determined by Bradford assay70 with Protein Assay Dye Reagent Concentrate (BIO-RAD). Samples were normalized by total protein content and run in a 10% SDS-PAGE gel for protein separation ...
-
bioRxiv - Cell Biology 2019Quote: Non-transfected and transfected cells were lysed in MNT and the PNS was isolated by centrifugation followed by total protein concentration determination using 595 nm Protein Assay Dye Reagent (Bio-Rad). All subsequent steps were conducted at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... EVs were characterized based on particle size and number using nanoparticle tracking analysis (NS300, Nanosight) and protein concentration (DC protein assay, Bio-Rad).
-
bioRxiv - Genetics 2021Quote: ... the ratio of droplets positive for these sequences versus droplets positive to a reference gene (RPP30 PrimePCR™ Probe Assay, BioRad) was used as a readout ...
-
bioRxiv - Developmental Biology 2021Quote: ... Aliquots of larval homogenate were removed prior heat-treatment to measure soluble protein using a Bradford assay (Bio-Rad 500-0006) with BSA standard curves.
-
bioRxiv - Biochemistry 2020Quote: ... The GlcA-T activity was assessed by subtracting the background observed in the negative control sample without donor sugar and normalized against the amount of protein measured using the DC Protein Assay (Bio-Rad).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Expression of Ace2 and the reference gene Gapdh were measured by Reverse Transcriptase droplet digital PCR (Prime ddPCR assays, QX200, Bio-Rad). Gene expression was quantified as the transcript ratio of Ace2 to Gapdh.
-
bioRxiv - Molecular Biology 2020Quote: ... Extracts were then incubated on ice for 10 min before protein concentration was calculated by Bradford assay (Bio-Rad, 500-0006). Extracts were then mixed with Laemmli buffer and boiled at 95°C for 5 minutes before loading on SDS-PAGE gels.
-
bioRxiv - Genomics 2019Quote: ... We purified the debranched DNA using one volume of Agencourt® AMPure® XP magnetic beads and checked DNA concentration using a Qubit dsDNA BR assay and DNA integrity of using electrophoresis on a 12K DNA chip (Experion, Bio-Rad).
-
Histone deacetylase inhibitors butyrate and bufexamac inhibit de novo HIV-1 infection in CD4 T-cellsbioRxiv - Microbiology 2020Quote: ... supplemented with 1 mM DTT for reduction of disulfide bonds and protein concentration was determined by Quick-start Bradford assay (Bio-Rad). Proteins were alkylated with 5.5 mM chloracetamide (45 min ...
-
bioRxiv - Cell Biology 2020Quote: ... lysates were cleared by centrifugation at 16000xg for 5 min at 4°C and the total protein concentration in the lysates was measured by Bradford protein assay (Bio-Rad). For western blot analysis 25 µg of each lysate was boiled for 5 min at 98°C (for the detection of LC3B and ATG9A samples were heated at 60°C for 10 min ...
-
bioRxiv - Immunology 2021Quote: ... Samples were centrifuged and the protein content of the supernatant was measured using the Protein Assay Dye Reagent (Biorad, #500-0006). Immunoblotting was performed using from 10 to 50 μg of protein lysate ...
-
bioRxiv - Immunology 2019Quote: ... The lysates were transferred to a new Eppendorf tube and total protein in each sample was determined using Lowry assay (Bio-Rad). Equal protein (20ug per lane ...
-
bioRxiv - Developmental Biology 2019Quote: ... Single cell qPCR was performed using the Fluidigm BioMark system on 96.96 Dynamic Array IFCs for Gene Expression using Delta Gene Assays and 2X SsoFast EvaGreen Supermix with low ROX (Bio-Rad). For data-processing ...
-
bioRxiv - Developmental Biology 2019Quote: ... Single cell qPCR was performed using the Fluidigm BioMark system on 96.96 Dynamic Array IFCs for Gene Expression using Delta Gene Assays and Sso Fast EvaGreen Supermix with Low ROX (Bio-Rad). Single cell qPCR was performed using the Fluidigm BioMark system on 96.96 Dynamic Array IFCs for Gene Expression using Delta Gene Assays and 2X SsoFast EvaGreen Supermix with low ROX (Bio-Rad) ...
-
bioRxiv - Microbiology 2019Quote: ... The amount of protein in the biomass was determined by the Quick Start™ Bradford Protein Assay (BioRad, Mississauga, ON, Canada). The denitrification rates were calculated by the linear portion of the NO3− plus NO2− concentrations (NOx ...
-
bioRxiv - Neuroscience 2021Quote: ... The cAMP levels were normalized to the total protein concentration in the supernatant determined by Bradford Assay using BSA standard curve (Bio-Rad). The final cAMP concentration is expressed as pmol cAMP per mg of total protein ...
-
bioRxiv - Neuroscience 2021Quote: ... quantified by micro-BCA assay (Pierce) in duplicate extracts) on 4-20% gradient Bis-Tris polyacrylamide stain-free pre-cast gels (Bio-Rad) in denaturing conditions ...
-
bioRxiv - Neuroscience 2021Quote: ... and sonicated (twice; 70 % power for 30 sec, Sonopuls, Bandelin) prior to protein concentration determination with the DC Protein Assay (Bio-Rad) according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mutations in ESR1 (hotspots D538 and Y537) and PIK3CA (hotspots E453 and H1047) were detected by either ddPCR assay using the QX200 ddPCR System (Bio-Rad) or through the Guardant360™ high sensitivity next-generation sequencing platform (Guardant Health ...
-
bioRxiv - Cancer Biology 2020Quote: ... and growth factors in culture supernatants of control or R1881 treated LNCaP cells was determined using the Bioplex Pro Human Cytokine 17-plex assay system (Bio-Rad) according to manufacturer’s protocol ...