Labshake search
Citations for New England Biolabs :
101 - 150 of 615 citations for Universal TT epitope P2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... using Luna® Universal qPCR Master Mix (New England Biolabs, USA) and gene-specific primers (Table S5) ...
-
bioRxiv - Microbiology 2022Quote: ... qRT PCR was performed using Luna Universal qPCR master mix (NEB) as per manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl of Luna® universal qPCR master mix (#M3003L, NEB), and 3 µl of nuclease-free water ...
-
bioRxiv - Systems Biology 2019Quote: ... and the Luna Universal One-Step RT-qPCR Kit (NEB, E3005E) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... or Luna Universal One-Step RT-qPCR Kit (New England Biolabs). Primer sequences used are described in Table S2 ...
-
bioRxiv - Genomics 2021Quote: ... qPCR was performed using the Luna Universal qPCR Master Mix (NEB) in technical duplicate with a StepOnePlus Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Biochemistry 2022Quote: ... by Luna Universal One-Step RT-qPCR Kit (New England BioLabs) according to the manufacturer protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were amplified with Luna Universal qPCR Master Mix (NEB, USA) according to manufacturer’s instructions in a Mx3005 qPCR system (Agilent ...
-
bioRxiv - Developmental Biology 2022Quote: ... qPCR was performed with the Luna Universal qPCR Master Mix (NEB) on an ABI PRISM 7000 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... and 10 μl 2X Luna Universal One-step Reaction mix (NEB). Samples were measured in triplicates ...
-
bioRxiv - Plant Biology 2023Quote: ... using Luna Universal Sybr Green master mix (NEB, Ipswich MA, USA) and 0.25uM each primer (Eurofins ...
-
bioRxiv - Microbiology 2023Quote: ... which contained 10 μL Luna Universal qPCR mastermix (New England Biolabs Inc. ...
-
bioRxiv - Cell Biology 2023Quote: ... Gene expression was determined using Luna Universal qPCR Master Mix (BioLabs) using Roche LightCycler96 system ...
-
bioRxiv - Microbiology 2023Quote: ... and Luna Universal one-step qRT-PCR kit (New England BioLabs) as previously described (13 ...
-
bioRxiv - Genetics 2023Quote: ... 5μL of 2× Luna Universal qPCR Master Mix (NEB, MA, USA). The amplification program was set as follows ...
-
bioRxiv - Systems Biology 2023Quote: ... using the Luna Universal One-Step RT-qPCR Kit (NEB, #E3005). No template and genomic DNA controls were included in all experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... Luna® Universal One-Step RT-qPCR Kit (NEB, Ipswich, Massachusetts) was used to quantify the RNA samples per the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR was performed using Luna® Universal qPCR Master Mix (NEB) in technical triplicates with primers specific for GAPDH ...
-
bioRxiv - Microbiology 2023Quote: ... The Luna Universal One-Step RT-qPCR Kit (New England Biolabs) was used for the detection of viral genomes in the heat-inactivated samples performed through reverse transcription quantitative polymerase chain reaction (RT-qPCR) ...
-
bioRxiv - Bioengineering 2023Quote: ... and according to the Luna Universal qPCR Master Mix protocol (NEB). Reaction volumes of 10 μL ...
-
bioRxiv - Cell Biology 2023Quote: ... using a universal qPCR master mix (New England Biolabs, Ipswich, MA). All qPCR primer sequences are in Table S2 ...
-
bioRxiv - Pathology 2024Quote: ... and Luna® Universal qPCR Master Mix (M3003E, New England BioLabs) on a LightCycler 480 II (Roche Diagnostics ...
-
bioRxiv - Physiology 2024Quote: ... and Luna Universal qPCR Master Mix (New England Biolabs, Ipswich, MA). Targeted genes related to gluconeogenesis and glucose transporter were ...
-
bioRxiv - Microbiology 2024Quote: ... using the Luna universal qPCR Master Mix (New England Biolabs, M3003) for cellular genes or the Luna universal probe qPCR Master Mix (New England Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: ... The 3xHA epitope tag in the knock-in construct was replaced by a 3xFlag epitope tag using the Q5 site-directed mutagenesis kit (NEB). The newly generated knock in sequence was amplified in a multi-step PCR reaction adding the terminator sequence from the pEv200 plasmid and BssHI and HindIII restriction site ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments located upstream and downstream to the epitope insertion sites were amplified by PCR using the Q5® High-Fidelity 2 × Master Mix (NEB) with relevant primers (Table 1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... using the Luna Universal One-Step RT-qPCR kit (New England BioLabs) and primer sets validated in our lab (Supplemental Table 5) ...
-
bioRxiv - Genomics 2019Quote: ... Universal and index primers from NEBNext Multiplex Oligos for Illumina (NEB #E7335S) were incorporated by a 12 cycle PCR ...
-
bioRxiv - Microbiology 2021Quote: ... using Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with an in-house developed protocol ...
-
bioRxiv - Microbiology 2020Quote: ... or Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) or LightCycler® Multiplex RNA Virus Master (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3.6 µl Luna Universal Probe qPCR Master Mix (New England BioLabs). The primers were described previously (Fernandez-Mosquera et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... Reactions contained the Luna Universal qPCR Master Mix (NEB, Ipswich, Massachusetts, USA), 0.25 µM of each primer and 100 ng template cDNA in 20 µl final volume ...
-
bioRxiv - Microbiology 2021Quote: ... We used Luna® Universal qPCR Master Mix (New England Biolabs, Inc), following protocol manufacturer ...
-
bioRxiv - Microbiology 2022Quote: ... qPCR was performed using Luna Universal qPCR Master Mix (New England Biolabs) with 1:5 diluted cDNA in technical duplicate in a StepOne Plus qPCR instrument (Applied Biosystems) ...
-
bioRxiv - Systems Biology 2021Quote: ... NEB_EC2H_Barcode_F: GACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGAACTATTTCCTGGCTGTTACGCG and NEBNext Universal PCR Primer for Illumina (New England Biolabs). The thermocycling parameters were 95 °C for 3 min ...
-
bioRxiv - Genomics 2021Quote: ... and Luna Universal One-Step RT qPCR Master Mix kit (NEB E3005L) and Tween-20 (Sigma-Aldrich P1379) ...
-
bioRxiv - Neuroscience 2021Quote: ... Luna® Universal qPCR Master Mix (New England Biolabs, Catalog No: M3003L) and DEPC treated water ...
-
bioRxiv - Microbiology 2020Quote: ... with the aid of the universal quantification kit NEBNext (New England Biolabs), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... qPCR reactions were set up using Luna Universal qPCR Master Mix (NEB) following the manufacturer's protocol ...
-
bioRxiv - Microbiology 2022Quote: ... qRT-PCR was performed using Luna Universal qPCR Master Mix (NEB; M3003) with SYBR Green ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... qPCR was performed using Luna Universal qPCR Master Mix (New England Biolabs) on an ABI ViiA-7 Thermocycler (Applied Biosystems) ...
-
bioRxiv - Biophysics 2022Quote: ... The reaction mixture contains Luna Universal qPCR Master Mix (New England Biolabs), 200 nM each of the primers ...
-
bioRxiv - Microbiology 2022Quote: ... or Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) or LightCycler® Multiplex RNA Virus Master (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-qPCR (Luna® Universal qPCR Master Mix; New England BioLabs; M3003L) was performed in 384-well plates (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... or Luna Universal Probe qPCR Master Mix (New England Biolabs; Ipswich, MA) and a Stratagene MX3000P or Applied Biosystems QuantStudio3 qPCR machine as previously described (20–22) ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR was performed using the Luna Universal Probe qPCR Master Mix (NEB) together with primer probes for IFN-β (Thermo Fischer Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative PCR was performed with Luna® Universal qPCR Master Mix (NEB). All procedures were carried out according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The Luna Universal qPCR Master Mix kit (New England Biolabs, Frankfurt, Germany) was used to perform qRT-PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCRs were performed using Luna® Universal qPCR Master Mix (NEB) and acquired on a QuantStudio 3 system (Applied Biosystems ...
-
bioRxiv - Biochemistry 2023Quote: ... and the Luna Universal Probe One-Step RT-qPCR Kit (NEB E3006) were used to detect the N1 (FAM ...