Labshake search
Citations for New England Biolabs :
201 - 250 of 6954 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and Q5 Hot Start High-Fidelity 2x master mix (NEB, Ipswich, MA) and the following protocol ...
-
bioRxiv - Genomics 2021Quote: ... or Q5 Hot Start High-Fidelity 2x Master Mix (New England BioLabs) unless otherwise noted ...
-
bioRxiv - Bioengineering 2021Quote: ... Q5 High-fidelity 2X Master Mix (New England Biolabs, Ipswich, MA, USA) was used with the following cycling conditions ...
-
bioRxiv - Bioengineering 2022Quote: ... then PCR amplified using the Q5 High-Fidelity 2X Master Mix (NEB). For the tetrahedra with 5 and 7 helical turns per edge ...
-
bioRxiv - Genomics 2022Quote: ... and 25μl Q5 High Fidelity 2X Master Mix (M0492, New England Biolabs) in 50μl total volume with 10 cycles amplification ...
-
bioRxiv - Microbiology 2022Quote: ... 12.5 µl Quick-Load Taq 2X Master Mix (M0271L, New England Biolabs) and 2 µl template (colony resuspended in TE-T) ...
-
bioRxiv - Genomics 2022Quote: ... and 20 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541L) were added to each well ...
-
bioRxiv - Bioengineering 2023Quote: ... 50 μl of Q5 High-Fidelity 2x Master Mix (New England Biolabs) and water.
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were assembled via Gibson Assembly (New England BioLabs 2X Master mix) (62 ...
-
bioRxiv - Microbiology 2023Quote: ... Genes were PCR-amplified (New England Biolabs Q5 HotStart 2X Master Mix) from a high-titer Hammy lysate using a forward primer complementary to the first 15-25 bp of each gene sequence (Integrated DNA Technologies) ...
-
bioRxiv - Bioengineering 2023Quote: (Optional) OneTaq Quick-Load 2X Master Mix (NEB cat. No. M0486S/L), for genotyping only
-
bioRxiv - Cell Biology 2023Quote: ... Genomic PCRs were performed using Hot Start Taq 2x Master Mix (NEB). PTGER2 primers that bind to conserved sequences in both human and mouse were used as internal control ...
-
bioRxiv - Genomics 2023Quote: ... and amplified using NEBnext High-Fidelity 2x PCR Master Mix (NEB, M0541L) and custom indexed primers68 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library was prepared with NEBNext High-Fidelity 2X PCR Master Mix (NEB) and SYBR Green I (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and amplified using high-fidelity 2X PCR Master Mix (New England Biolabs) using primers with standard ATAC-seq barcodes (Buenrostro et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 25 µl of NEBNext HiFi 2x PCR Master Mix (New England BioLabs) was mixed with 21 µl of the CUT&Tag DNA ...
-
bioRxiv - Genomics 2024Quote: RT-PCR was conducted using Quick-Load Taq 2X Master Mix (NEB). For molecular cloning applications Q5 High-Fidelity DNA polymerase (NEB ...
-
bioRxiv - Developmental Biology 2024Quote: ... Genotyping was performed with Quick-Load Taq 2X Master Mix (M0271L, BioLabs), on 2% agarose gel for the PCR bands ...
-
bioRxiv - Genomics 2021Quote: ... Tagmented DNA fragments were amplified by adding 12 µL PCR master mix composed of 11 µL Q5 High-Fidelity 2x Master Mix (New England Biolabs, #M0492) and 0.5 µL each of 10 mM Nextera i5 and i7 index primers ...
-
bioRxiv - Cell Biology 2020Quote: ... were reinjected at 75 μl/h and co-flowed with 150 μl/h PCR mix (1.65x NEBNext Ultra II Q5 Master Mix, 0.033 U/μl USER II (NEB), 1.32 M Propylene glycol ...
-
bioRxiv - Genetics 2021Quote: ... RT-PCR was conducted using the Q5 High-Fidelity 2X Master Mix (NEB). All primers used in the current study are available in Table S1.
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were prepared using NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541) with the following conditions ...
-
bioRxiv - Molecular Biology 2020Quote: ... except that 5 uL of Phusion Hot Start Flex 2X Master Mix (NEB) was used ...
-
Pancreatic progenitor epigenome maps prioritize type 2 diabetes risk genes with roles in developmentbioRxiv - Genomics 2020Quote: ... Libraries were amplified using NEBNext High-Fidelity 2X PCR Master Mix (M0541, NEB) with primer extension at 72°C for 5 minutes ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were amplified using NEBNext High-Fidelity 2X PCR Master Mix (M0541, NEB) with primer extension at 72°C for 5 minutes ...
-
bioRxiv - Genetics 2021Quote: ... and 25 uL of NEBNext Q5U 2X Master mix (New England Biolabs M0597S), and 0.5uL 100X SYBR Green I (Thermo Scientific S7563 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The first amplification was conducted using OneTaq 2X Master Mix (NEB, Ipswich MA), a total of 6 μg genomic DNA and a limited amount of primers in 6 × 50 μL reactions with the following composition ...
-
bioRxiv - Bioengineering 2020Quote: ... with 12.5μL LongAmp Taq 2X Master Mix (New England Biolabs, Inc., Ipswich, MA), 9.5μL of H2O ...
-
bioRxiv - Neuroscience 2020Quote: ... Libraries were prepared with NEBNext High-Fidelity 2X PCR Master Mix (NEB M0541L), following standard protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR was performed using 2x LongAmp Taq Master Mix (New England Biolabs, M0287S) to select full- length transcripts followed by a second purification step using Agencourt beads (as described above) ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified for 13 cycles using Q5 High-Fidelity 2X Master Mix (NEB) according to manufacturer's instructions ...
-
bioRxiv - Genetics 2021Quote: ... 10 μl of Q5 Hot Start High-Fidelity 2x Master Mix (NEB M0494S), 1 μl of 10 μM shRNA_GA_F primer (5’ GAGAACTCTGAATAGATCTGTTCTAGAAAACATCCCATAAAACATCCCATATTCA-3’) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Each PCR2 reaction contains 25µL of Q5 High-Fidelity 2X Master Mix (NEB), 2.5µL of a unique Nuc PCR#2 Fwd Primer (10µM) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Each “PCR1” reaction contains 25µL of Q5 High-Fidelity 2X Master Mix (NEB), 2.5µL of Nuc PCR#1 Fwd Primer (10µM) ...
-
bioRxiv - Developmental Biology 2022Quote: ... using the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs #M0451S) with Nextera DNA CD Indexes (Illumina #20015882) ...
-
bioRxiv - Genetics 2022Quote: Conversion tracts were PCR amplified using OneTaq 2x Master Mix (New England Biolabs). Noncrossover recombination products were amplified using forward primer DLO822 (5’-ATTTTAACCCTTCGGGGTACG-3’ ...
-
bioRxiv - Biophysics 2022Quote: ... We performed routine cloning using Q5 high-fidelity 2X master mix (NEB M0492) for PCR amplification and isothermal assembly using 2X Gibson master mix (NEB E2611 ...
-
bioRxiv - Biophysics 2022Quote: ... for PCR amplification and isothermal assembly using 2X Gibson master mix (NEB E2611) before transformation into NEB Stable or 5-alpha chemically competent cells.
-
bioRxiv - Developmental Biology 2021Quote: ... and then amplified with NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541L). Libraries were sequenced on HiSeq 125bp paired-end platform.
-
bioRxiv - Genetics 2019Quote: ... and 10 µL 2X Hot Start Taq PCR Master Mix (New England Biolabs). The cycling conditions in the Bio-Rad T100™ Thermal Cycler were ...
-
bioRxiv - Genetics 2019Quote: ... and 12.5 µL 2X Hot Start Taq PCR Master Mix (New England Biolabs). Samples were run on a Bio-Rad T100™ Thermal Cycler and cycled for 5 minutes at 95°C ...
-
bioRxiv - Genetics 2019Quote: ... and 10 µL 2X Hot Start Taq PCR Master Mix (New England Biolabs). Samples were loaded into a Biorad T100™ Thermal Cycler for 3 minutes at 95°C ...
-
bioRxiv - Microbiology 2019Quote: ... 20] and LongAmp™ Taq 2X Master Mix (New England Biolabs, Ipswich, MA). Amplification was performed using an Applied Biosystems Veriti™ Thermal Cycler (Thermo Fischer Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... PCR reactions were performed using Q5® High-Fidelity 2x Master Mix (NEB) for cloning and sequencing otherwise DreamTaq Green PCR Master Mix 2x (Thermo Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Either 2X Luna Universal qPCR Master Mix (New England Biolabs, Ipswisch, ME, USA) or 2X TaqMan Fast Advance Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2019Quote: ... We used the Q5 High-Fidelity Polymerase 2x Master Mix (New England Biolabs) to amplify genes and vectors under the following general conditions ...
-
bioRxiv - Immunology 2020Quote: ... using Q5® Hotstart High-Fidelity 2X Master Mix (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Immunology 2020Quote: ... using Q5® Hotstart High-Fidelity 2X Master Mix (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Synthetic Biology 2019Quote: ... libraries were amplified using Q5 High-Fidelity 2X Master Mix (New England Biolabs), a final primer concentration of 0.8 µM ...
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were then amplified with 2X NEBNext master mix (NEB, Ipswitch, MA M0541S) using cycle numbers determined by qPCR as described in the standard ATAC-seq protocol (Buenrostro et al. ...