Labshake search
Citations for New England Biolabs :
401 - 450 of 6954 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... The PCRs were performed with Q5® High-Fidelity 2X Master Mix (New England Biolabs) with the designed synthetic primers (SigmaAldrich) ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR was amplified with high-fidelity 2x PCR Master Mix (New England Biolabs M0541). One-third of the maximum fluorescent intensity during a qPCR trial run was used to determine the additional cycles for library prep ...
-
bioRxiv - Bioengineering 2022Quote: Genomic PCR was performed using NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs) with the primers listed in Supplementary Table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reaction mixture contained: 12.5 µL LUNA LongAmp Taq 2x Master Mix (NEB M0287S), 5.5 µL Nuclease-Free Water (ThermoFisher Scientific #AM9937) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Colony PCR was performed using Quick-Load Taq 2X master mix (New England Biolabs, M0271L). Successful colonies were grown in 100 μg/mL ampicillin-rich lysogeny broth (LB ...
-
bioRxiv - Biochemistry 2023Quote: ... Amplification was done using the Q5 High-Fidelity 2X Master Mix (NEB, catalog no. M0492S) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by PCR amplification using NEBNext High-Fidelity 2X PCR Master Mix (NEB). The resulting libraries were multiplexed and sequenced in a HiSeq 4000 paired-end lane ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR was performed with 2x NEBNext High-Fidelity PCR Master Mix (New England Biolabs, M0541S) and 10 μM primers (Table S2 ...
-
bioRxiv - Genomics 2023Quote: ... The outward PCR experiments were performed using NEBNext High-Fidelity 2X PCR Master Mix (NEB). For a 50 µl reaction ...
-
bioRxiv - Microbiology 2023Quote: ... PCR reactions were performed with 2x OneTaq HotStart DNA Polymerase master mix (New England Biolabs), using 6 μl of forward and reverse primer (1μM each) ...
-
bioRxiv - Molecular Biology 2023Quote: ... ATAC-seq libraries were prepared using NEBNext High-Fidelity 2X PCR Master Mix (NEB, #M0541), a uniquely barcoded primer per sample ...
-
bioRxiv - Genomics 2023Quote: ... pooled oligonucleotides were amplified via PCR using NEBNext 2X Hi-Fi PCR Master Mix (NEB) and primers:
-
bioRxiv - Genetics 2023Quote: ... 200ng of RNA-equivalent cDNA was amplified with LongAmp Taq 2X Master Mix (NEB #M0287S) and gene-specific primers tailed with Oxford Nanopore universal sequences (Supplementary Table S3) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μL of each ATAC-seq library was added to 2x NEBNext Master Mix (NEB) and 0.4x SYBR Green (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were generated by PCR amplification using NEBNext High-Fidelity 2X PCR Master Mix (NEB). The resulting libraries were purified using MinElute PCR Purification Kit (Qiagen) ...
-
bioRxiv - Immunology 2023Quote: ... 12.5 µl of OneTaq Quick-Load 2X Master Mix with Standard Buffer (New England Biolabs), 2 µl of diluted (1:10 ...
-
bioRxiv - Microbiology 2023Quote: ... and PCR carried out using Q5® High-Fidelity 2X Master Mix (New England Biolabs) as per manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... 7 μL of 2x NEBNext Library Quant Master Mix with 1:100 low ROX (NEB), and 1.5 μL ddH2O ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All in vitro PCR reactions were performed using Q5 High-Fidelity 2X Master Mix (NEB). Yeast colony PCR reactions were done as previously reported20 using DreamTaq DNA polymerase (ThermoFisher) ...
-
bioRxiv - Genomics 2023Quote: ... Pre-amplification was performed by addition of 30 μL 2x Q5U Master Mix (NEB M0597S), 0.4 μL 100 μM pre-amplification forward primer and 0.4 μL 100 μM pre-amplification reverse primer (SI Appendix ...
-
bioRxiv - Biophysics 2023Quote: ... and Q5 Hot Start High-Fidelity 2X PCR Master Mix (New England Biolabs, Ipswich, MA). The transcribed region had the following spacings ...
-
bioRxiv - Microbiology 2024Quote: ... All PCR reactions were performed using Q5 High-Fidelity 2X Master Mix (NEB, Frankfurt, Germany). The PCR product was purified and sequencing was done using a gene specific primer (GSP3) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR assembly was performed using the Q5 High-Fidelity 2X Master Mix (New England Biolabs), 4 µM of 5′ terminal primer ...
-
bioRxiv - Genomics 2023Quote: ... and PCR amplification with Q5® High-Fidelity 2X Master Mix (NEB, catalog no. M0492S). PCR products were confirmed by Sanger sequencing (Genewiz)
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µl of LongAmp Taq 2x master mix (New England Biolabs, Ipswich, Massachusetts, United States), and 2.5 µl of the PCR product as template ...
-
bioRxiv - Bioengineering 2024Quote: ... amplified with Q5® Hot Start 2x Master Mix (New England Biolabs, Ipswich, Massachusetts, US). Target DNA was purified with a PureLink® PCR cleanup kit (Invitrogen) ...
-
bioRxiv - Bioengineering 2024Quote: ... PCRs were carried out using the Q5 Hot Start 2x Master Mix (NEB, Ipswich, MA) according to the manufacturer’s protocol for 30 cycles ...
-
bioRxiv - Cell Biology 2024Quote: ... The editing region was amplified with PCR using Q5 High-Fidelity 2X Master Mix (NEB) followed by purification the PCR product using the QIAquick PCR Purification Kit (QIAGEN) ...
-
bioRxiv - Immunology 2024Quote: ... The reaction consisted of 50 µL of NEBNext High Fidelity 2X PCR Master Mix (NEB), 4 µg of genomic DNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Twist Bioscience) followed by PCR amplification using NEBNext HiFidelity 2X Master Mix (New England BioLabs) with Fwd Primer (GTAACTTGAAAGTATTTCGATTTCTTG- GCTTTATATATCTTGTGGAAAGGACGAAACACC ...
-
bioRxiv - Microbiology 2020Quote: ... PCR (NEBNext Ultra II Q5 ® Master Mix, NEB, Ipswich, MA, USA) was performed with a gene-specific forward primer designed 700-nt upstream of the apparent boundary between the SARS-CoV-2 genome body and the putative poly-A tail ...
-
bioRxiv - Genomics 2022Quote: ... 25 μl NEBNext® Ultra™ II Q5® Master Mix (NEB) and the whole purified DNA sample (5 min 72°C ...
-
bioRxiv - Genetics 2022Quote: ... Eluted cDNA was amplified 5-cycles (NEBNextµltra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...
-
bioRxiv - Genomics 2022Quote: ... Eluted DNA was amplified using NEBNext Ultra II PCR Master Mix (NEB) and purified using AMPure XP beads ...
-
bioRxiv - Genomics 2021Quote: ... 12.5 µL of NEBNext Ultra II Q5 master mix (NEB, Cat #M0544L), and H2O to a total 25 µL reaction volume ...
-
bioRxiv - Molecular Biology 2021Quote: ... A PCR cocktail consisting of NEBNext Ultra II Q5 master mix (NEB) and Illumina TruSeq PCR primers (RP-1 ...
-
bioRxiv - Genomics 2021Quote: ... we used NEBNext® Ultra™ II Q5® Master Mix (NEB). This master mix contains Q5® High Fidelity DNA Polymerase ...
-
bioRxiv - Genomics 2022Quote: ... Eluted DNA was amplified using NEBNext Ultra II PCR Master Mix (NEB) and purified using AMPure XP beads ...
-
bioRxiv - Molecular Biology 2022Quote: ... by adding 25 μl of NEBNext Ultra II Q5 Master Mix (NEB), 11 μl Nuclease free water and 2 μl of RP1 and RPIx primers (10 μM) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Eluted DNA was amplified using NEBNext Ultra II PCR Master Mix (NEB) and purified using AMPure XP beads ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... long-range PCR was performed to amplify the complete gene with the same mix composition as above except that the LongAmp HotStart Taq 2X Master Mix (New England Biolabs) was used instead ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 μl cDNA reaction mix was amplified by adding 25 μl of Long Amp Taq 2x Master Mix (NEB-kit), 1.25 μl SR primer for Illumina (NEB-kit) ...
-
bioRxiv - Immunology 2022Quote: ... cells were brought to 5×105 cells/ml and incubated with transposition reaction mix (NEBNext High-Fidelity 2X PCR master mix, NEB) for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR reaction was performed using 1 μl of undiluted cDNA template synthesized from 1 µg of total RNA extracted from a mix of male and female individuals using Q5 Hot Start High-Fidelity 2X Master Mix (NEB), as described above ...
-
bioRxiv - Molecular Biology 2022Quote: ... tagmented DNA was PCR amplified using 1x Phusion® High-Fidelity PCR Master Mix with GC Buffer (NEB) and 1.25 μM i5 and i7 PCR primers (Nextera® Index Kit (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was amplified using Q5® High-Fidelity 2X Master Mix (New England BioLabs® M0492L) from 100ng of genomic DNA according to the protocol provided by the manufacturer ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR reactions were prepared using Q5 High-Fidelity 2X Master Mix (New England BioLabs, Ipswich, MA) and 10 ng genomic DNA in a final volume of 25 μl ...
-
PD-1 checkpoint blockade disrupts CD4 T cell regulated adaptive B cell tolerance to foreign antigensbioRxiv - Immunology 2021Quote: ... 10 ng of genomic DNA was amplified using LongAmp Taq 2X Master Mix (New England BioLabs) and the provided barcoded 16S primers ...
-
bioRxiv - Microbiology 2019Quote: ... DNA fragments were PCR amplified using Q5® Hot Start High-Fidelity 2X Master Mix (NEB) and oligonucleotides described in Table S1 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 µl were used for amplification with Taq 2X Master Mix (New England Biolabs, Ipswitch, USA) using a 20-cycles PCR protocol ...