Labshake search
Citations for New England Biolabs :
151 - 200 of 6954 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... 25μL Q5 High Fidelity 2x master mix (New England BioLabs, M0492) in a final volume of 50μL ...
-
bioRxiv - Plant Biology 2023Quote: ... using Q5® High-Fidelity 2X Master Mix (New England Biolabs). The two fragments were annealed and extended by overlapping PCR ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR was performed using Q5 High Fidelity 2X Master Mix (NEB) with primers purchased from Integrated DNA Technologies (IDT ...
-
bioRxiv - Neuroscience 2023Quote: ... 25µL NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs), and 5µL of Nextera i5 and i7 indexed amplification primers (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... 50 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S), 2.5 µL STAG_P701_NEX (10 uM) ...
-
bioRxiv - Genomics 2023Quote: ... 50 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S), 2.5 µL 10 μM STAG_iP7_a1 oligo (5’-CAAGCAGAAGACGGCATACGAGATATTTACCGCAGTGACTGGAGTTCAGACGT*G*T-3’) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S), 36.9 μL nuclease-free water and 2.5 μL of 10 μM sample index N (10x Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... 50 µL of Q5® High-Fidelity 2X Master Mix (NEB), 5 µL each of 10 µM primer P1 and P2 (ACACTCTTTCCCTACACGACGCTCTTCCGATCTAAGGGCA GGCTGGGAAAT) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Duplex PCR was performed using Q5 Hotstart 2x Master Mix (NEB) with final primer concentrations of 0.5uM ...
-
bioRxiv - Developmental Biology 2023Quote: ... 72°C for 1 min) using NEBNext 2x Master Mix (NEB) and Nextera adapters and put on ice ...
-
bioRxiv - Genomics 2024Quote: ... 0.2X of 2X Instant Sticky-end Ligase Master Mix (NEB, M0370), 0.8X of 5X Quick Ligase Buffer (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... Q5 2X Hotstart master mix (New England Biolabs, Ipswich, MA, USA) was used for cloning PCRs ...
-
bioRxiv - Microbiology 2020Quote: ... using 10 μl of the bead suspension in a 50 μl reaction with NEBNext Ultra II Q5 2x master mix (NEB) and 0.5 μM each Solexa 1GA/1GB primers (Solexa 1GA ...
-
bioRxiv - Genomics 2023Quote: ... BAC baits were PCR amplified using 5’ biotinylated forward and reverse primers (Supplementary Table S7) in the following reaction mix: 10 µl 2X NEBNext® Ultra™ II Q5® Master Mix (NEB cat. M0544S), 1 µl 10 µM each bio-primer ...
-
bioRxiv - Bioengineering 2021Quote: ... Reactions were performed with Phusion High-Fidelity Master Mix and GC buffer(NEB, US) using 1 to 30 ng of plasmid DNA templates ...
-
bioRxiv - Genetics 2023Quote: ... PCR reactions (15 μL) contained 7.5 μL of 2X OneTaq 2X Master Mix with Standard Buffer (NEB), 5.9 μL H2O ...
-
bioRxiv - Molecular Biology 2022Quote: ... 25 µl NEBNext Ultra II Q5 Master Mix (NEB) and indexed amplification primers (125 nM final concentration ...
-
bioRxiv - Genetics 2023Quote: ... using NEBNext Ultra II Q5 master mix (NEB M0544S). The PCR product was purified using Amicon Ultra-2mL 50K centrifugal filter (Millipore UFC205024 ...
-
bioRxiv - Genomics 2023Quote: ... Hi-C library was purified by adding 80 μl Ampure beads and amplified in two 100 μl pre-amplification reactions (50 μl 2x NEBNEXT Ultra II Q5 Master Mix (NEB, M0544L), 5 μl 10 μM Nextera-P5-pre-Primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... genomic DNA was isolated from bulk tumor-bearing lung tissue followed by PCR amplification of the sgID-BC region from 32 μg of bulk lung genomic DNA using Q5 Ultra II High-Fidelity 2x Master Mix (New England Biolabs, M0494X). Unique dual-indexed primers were used to amplify each sample followed by purification using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2023Quote: The purified cDNA was PCR amplified for 6 cycles to generate dsDNA with NEBNext Ultra II Q5 High-Fidelity 2X Master Mix (NEB, M0544) and 0.5 uM PCR primers with unique dual index using the following PCR cycles:
-
bioRxiv - Microbiology 2020Quote: ... 12.5 μL of 2x Hot Start Taq master mix (New England BioLabs), and 7 μL of water (=25 μL total volume) ...
-
bioRxiv - Microbiology 2020Quote: ... 25 μL 2x NEBnext High-Fidelity PCR Master Mix (New England Biolabs) and 10 μL nuclease-free distilled H2O (ThermoFisher Scientific) ...
-
Optimized immunoglobulin knock-ins using Cas9 reveal peritoneal B cell lineage relationships in vivobioRxiv - Immunology 2021Quote: ... All assemblies were performed with NEB HiFi 2X Master Mix (NEB #E2621L). Assembled constructs were transformed into XL-10 Gold Ultracompetent E ...
-
bioRxiv - Genetics 2021Quote: ... or Q5® High-Fidelity 2X Master Mix (New England Biolabs M0492S) and purified with the Qiagen QIAquick PCR Purification Kit (Qiagen 28104).
-
bioRxiv - Genomics 2020Quote: ... or Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs). Endo-free plasmids used for mammalian transfection were prepped using ZymoPURE II Plasmid Midiprep (Zymo Research Corporation ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed with Taq 2X Master Mix (New England BioLabs, Maine), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR genotyping was performed using Q5 High-Fidelity 2X Master Mix (NEB) with the primer pairs listed in Table 2 ...
-
bioRxiv - Bioengineering 2019Quote: ... Target sites were amplified using High Fidelity 2X PCR Master Mix (NEB). Primers used for PCR are listed in Supplementary Materials ...
-
bioRxiv - Genetics 2019Quote: ... The gBlocks were amplified using Q5 high fidelity 2X master mix (NEB) and gBlock amplification primers (Arbab et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... PCRs were performed using OneTaq 2X Master Mix with Standard Buffer (NEB) using the following primers ...
-
bioRxiv - Microbiology 2020Quote: ... LongAmp™ Taq 2x Master Mix (New England Biolabs, Ipswich, MA, USA), and Chai Green Dye 20x (Chai ...
-
bioRxiv - Synthetic Biology 2021Quote: ... DNA assembly was performed using NEBuilder 2x Master Mix (New England Biolabs). Standard ligation of restriction enzyme digest products was performed using the Roche Rapid Ligation Kit (Merck Life Sciences) ...
-
bioRxiv - Developmental Biology 2021Quote: ... gDNA was then used in Q5 High-Fidelity 2X Master Mix (NEB) PCR reactions according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 50μL Q5® Hot Start High-Fidelity 2X Master Mix (NEB # M0494L), and 5μL of a 10μM solution of each primer (P5 and P7) ...
-
bioRxiv - Neuroscience 2020Quote: ... plus 25 μl NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541L) was added to 20 μl of purified transposed DNA ...
-
bioRxiv - Genetics 2020Quote: ... 25 μL of High-Fidelity 2X PCR Master Mix (New England BioLabs), 2.5 uL of indexing primer and 10 μL of DDW were added to the 10 μL of purified DNA and the DNA was amplified five cycles using the following PCR program ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs) in a final volume of 25 µL.
-
bioRxiv - Microbiology 2021Quote: ... using the Q5 High-Fidelity 2X Master Mix (New England Biolabs, NEB), then digestions with restriction enzymes and ligation were performed ...
-
bioRxiv - Microbiology 2021Quote: ... using the Q5 High-Fidelity 2X Master Mix (New England Biolabs, NEB), then digestions with restriction enzymes and ligation were performed ...
-
bioRxiv - Evolutionary Biology 2020Quote: - 200μL OneTaq Hot Start 2X Master Mix with Standard Buffer (NEB M0484L)
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCR products were generated using the 2x Q5 PCR Master Mix (NEB) in accordance with manufacturer instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... and amplified using NEBNext® High-Fidelity 2X PCR Master Mix (NEB). The number of cycles was estimated by qPCR ...
-
Efficient Suppression of Endogenous CFTR Nonsense Mutations Using Anticodon Engineered Transfer RNAsbioRxiv - Molecular Biology 2021Quote: ... For all PCR reactions Q5 High-Fidelity 2X Master Mix (NEB M0492L) was used ...
-
bioRxiv - Microbiology 2020Quote: ... 12.5 μL of 2x Hot Start Taq master mix (New England BioLabs) and 10.5 μL of water (= 25 μL total volume) ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μL of 2x Hot Start Taq master mix (New England BioLabs) and 8.18 μL of water (= 20 μL total) ...
-
bioRxiv - Microbiology 2020Quote: ... 25 μL of 2x Hot Start Taq master mix (New England BioLabs) and 21.34 μL of water (=50 μL total volume) ...
-
bioRxiv - Microbiology 2020Quote: ... 12.5 μL of 2x Hot Start Taq master mix (New England BioLabs), and 10.5 μL of water (=25 ul total volume) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL 2x NEBnext High-Fidelity PCR Master Mix (New England Biolabs) and 2.9 μL nuclease-free distilled H2O (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... or Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs). All plasmids used in this work were freshly prepared from 50 mL of Mach1 culture using ZymoPURE Plasmid Midiprep (Zymo Research Corporation ...