Labshake search
Citations for New England Biolabs :
4401 - 4450 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... A PCR master mixture was prepared by combining 2,200 uL 2x NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs), 22 uL common P7 primer (100 uM ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10-15 ng of each PCR product were digested at 37 °C for 60 min with 2.5 units of XcmI (New England Biolabs) in 15 μl reactions ...
-
bioRxiv - Cell Biology 2023Quote: ... elegans osgn-1 (F30B5.4a, WormBase WS265) and human OSGIN1 were amplified by PCR using Phusion DNA polymerase (NEB, M0530L), according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... GRCh37/hg19) spanning the APA control region in DNAJB6 were generated using PCR (EpiMark-HS-TAQ, New England Biolabs), where one set of reactions used a 5-methylcytosine-containing dNTP mix (methylated probes ...
-
bioRxiv - Microbiology 2023Quote: ... All the cloning fragments were obtained by PCR amplification using Q5 polymerase according to the manufacturer’s instructions (cat. no. M0491L, New England Biolabs). Diagnostic PCR was performed using GoTaq polymerase (cat ...
-
bioRxiv - Microbiology 2023Quote: ... Near full-length 16S rRNA genes were amplified by PCR using Phusion Hi-Fidelity DNA Polymerase (New England BioLabs) and a bacteria-specific primer set ...
-
bioRxiv - Microbiology 2023Quote: The promoter of hvo_B0047 was amplified by PCR using Taq DNA polymerase as recommended by the company [New England Biolabs (NEB)] ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR products were inserted into pET28a using restriction digestion and ligation with EcoR 1 and Sal 1 (NEB) sites.
-
bioRxiv - Cancer Biology 2023Quote: ... The MR1 locus was amplified from the DNA using PCR with Q5 High-Fidelity DNA Polymerase (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and PCR amplified using Q5® Hot Start High-Fidelity 2X Master Mix (New England BioLabs; Ipswich, MA, USA). SafeSeqS(52 ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification was done in a 25µl reaction with 1 unit of NEB Taq DNA polymerase (NEB Catalog# M0273S), 1x Standard Taq Buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... SadCas9-2xKRAB-p2a segment was amplified by PCR from backbone using high-fidelity polymerase (Phusion, NEB, Cat. No. M0530S); and TurboRFP was PCR amplified using high-fidelity polymerase ...
-
bioRxiv - Molecular Biology 2023Quote: ... Re-joined ends were amplified by 35 cycles of PCR from 0.8 µl template using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and primers NOSprom-nested-F2 and TagRFP-nested-R2 (Table S1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cDNA was amplified in a 25 µl PCR reactions using 6 µl cDNA and 2X Master mix (NEB). The PCR cycling program was 98 °C for 30 seconds ...
-
bioRxiv - Genomics 2023Quote: ... Then equal amounts of purified linear A and B PCR products were mixed with the Taq DNA ligase (NEB) and its buffer ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing adapters were attached to the transposed DNA fragments using NEBNext Ultra II Q5 PCR mix (New England Biolabs), and libraries were amplified with 8 cycles of PCR ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were amplified by PCR for a total of 8 cycles in 100µL reactions with Phusion polymerase (New England Biolabs). No PAGE purification was performed to ensure that our libraries were not biased against short nascent RNA insertions.
-
bioRxiv - Immunology 2023Quote: ... Amplicon containing U6 promoter and sgRNA4 was PCR amplified using Phusion High-Fidelity DNA Polymerase (New England Biolabs, M0530) and assembled into SalI linearized LentiGuide-GBP-Chr3 sgRNA3 plasmid using HiFi DNA Assembly Kit (New England Biolabs ...
-
bioRxiv - Physiology 2023Quote: ... and the sizes of PCR products were calibrated using a 100-bp DNA Ladder (New England BioLabs, Ipswich, MA). Mice were genotyped using the following primer pairs ...
-
bioRxiv - Genomics 2023Quote: ... We performed qPCR on a StepOneTM Real-Time PCR System with the Luna® Universal qPCR Master Mix (NEB). Gene specific primers are outlined in Extended Data Table S4.
-
bioRxiv - Genomics 2023Quote: ... Sequences of DNMT3B transcripts were isolated from pcDNA4-DNMT3B1 and pcDNA4-DNMT3B3ΔEx5 plasmids33 by PCR and assembled with pLenti construct using Gibson assembly (New England Biolabs) following the manufacturer protocol.
-
bioRxiv - Molecular Biology 2023Quote: Preparative PCR for plasmid construction were performed with Q5 High-Fidelity DNA Poly-merase (New England Biolabs cat. #M0491S) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... The donor sequence for mScarlet and linker was PCR amplified from pmScarlet-i_C1 using Q5 High-Fidelity DNA polymerase (New England Biolabs).
-
bioRxiv - Bioengineering 2023Quote: ... 100 ng of the extracted gDNA were for PCR with the Q5 high-fidelity DNA polymerase (New England Biolabs). The product was analyzed via gel electrophoresis ...
-
bioRxiv - Biochemistry 2023Quote: ... End point PCR to detect expression of the transgene was performed using the Phusion high fidelity polymerase (#M0530L, NEB) protocol ...
-
bioRxiv - Biophysics 2023Quote: A 2070-bp DNA handle was amplified by PCR from λ DNA template (final 2.5 µg/ml; NEB, N3011S) using a forward primer (TAAGGATGAACAGTTCTGGC ...
-
bioRxiv - Genomics 2022Quote: ... We then amplified barcodes from both cDNA and DNA in 4 PCR reactions per sample using Q5 (NEB #M0492) and primers specific to the reporter genes (GWLP P3 ...
-
bioRxiv - Genomics 2023Quote: ... nuclei were sorted into a tube of a PCR tube strip containing 5 μL 1X CutSmart buffer (NEB, B7204S) per well ...
-
bioRxiv - Developmental Biology 2023Quote: ... A primer set annealing to the amplification sequences was used at a final concentration of 0.5 μM to amplify the pool of oligonucleotides using 12.5 μL 2 x NEBnext PCR master mix (New England BioLabs) and 3 μL of oligonucleotide pool (∼3 ng) ...
-
bioRxiv - Genetics 2022Quote: ... The PCR fragments were assembled into NdeI-digested pAct-dCBEevoAPOBEC1 using NEBuilder® HiFi DNA assembly (New England Biolabs).
-
bioRxiv - Genetics 2022Quote: ... The sequences of HS5 and NRE were PCR amplified from human genomic DNA using Phusion high fidelity polymerase (NEB). Hg38 genome coordinates and sequences of primers used ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... PCR fragments and SrfI-digested vector were combined with NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs #E2621) in a 2:1 ratio of insert to vector ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA sequence pertaining to Mxe intein-chitin-binding domain (CBD) was PCR amplified from pTXB1 (New England Biolabs) and ligated in frame at the C-terminus of H2AX(1-134) ...
-
bioRxiv - Microbiology 2023Quote: ... MotA-ASR inserts and linear vector were prepared by PCR amplification using Q5 high-fidelity (HF) DNA polymerase (NEB). The PCR reaction recipe and condition is provided to supplementary information ...
-
bioRxiv - Genomics 2022Quote: ... 5ul (or at least 60ng) of cDNA was mixed with 2x Q5 HF PCR Master Mix (New England Biolabs) and 500nM of P5/R1-par and P7/SI-R2 primers in a 50ul reaction volume and subjected to the following PCR program ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid inserts were amplified by PCR using the Q5® Hot-Start High-Fidelity 2X Master Mix (NEB). Site-directed mutagenesis was performed using the Q5® Site-directed mutagenesis kit (NEB ...
-
bioRxiv - Genetics 2023Quote: ... Input genomic DNA was first amplified in a 10μL reaction for 30 cycles using NEBNext High-Fidelity 2×PCR Master Mix (NEB). Amplicons were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was isolated and regions flanking Exon 5 were PCR-amplified using Q5 High-Fidelity DNA Polymerase (NEB) (oligonucleotide primers F ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µL i7 unique index primer (10 µM) and 25 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB) and subjected to the following PCR program ...
-
bioRxiv - Microbiology 2023Quote: ... This was followed by PCR using One Taq Quick-Load 2x Master Mix with Standard Buffer from BioLabs (UK).
-
bioRxiv - Biochemistry 2023Quote: ... DNA oligonucleotides were amplified using Phusion® High-Fidelity PCR Master Mix with HF Buffer (M0531L, New England BioLabs). AmpliScribe™ T7-Flash™ Transcription Kit (ASF3507 ...
-
bioRxiv - Genomics 2023Quote: ... we amplified pegRNA/ngRNA pair sequences from each sample using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and the following primers ...
-
bioRxiv - Microbiology 2023Quote: ... Amplified PCR products were ran on 2% agarose gel and stained with ethidium bromide solution (New England Biolabs Inc.). Gel photographs were taken using ChemiDoc MP gel documentation system (BIO-RAD).
-
Understanding Campylobacter coli isolates from the Vietnamese meat production network; a pilot studybioRxiv - Microbiology 2023Quote: ... manufacturer recommended PCR conditions were used with eight minutes amplification using NEB LongAmp Taq 2X Master Mix (NEB M0287). DNA end repair was performed using NEBNext Ultra II End repair/dA-tailing Module (E7546) ...
-
bioRxiv - Genomics 2023Quote: ... Ten-fold diluted cDNA was used in qRT-PCR using Luna Universal qPCR Master Mix (New England Biolabs #M3003E) in a final 10 µL reaction in QuantStudio 3 Real-Time PCR machine (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: The coding region of cDNA clone FI18815 was PCR amplified and cloned in frame into pENTR4 (HiFi assembly, NEB) and then into pPHW using Clonase (Life Tech.) ...
-
bioRxiv - Cancer Biology 2023Quote: ... the region of interest was minimally amplified through a 7-cycle PCR (Phusion® High-Fidelity DNA Polymerase, NEB) surrounding the mtDNA regions for ddPCR detection ...
-
bioRxiv - Bioengineering 2023Quote: ... and assembled with PCR amplified (primers 2 and 3) pRSET vector fragment using Gibson assembly (NEB Japan, Tokyo, Japan) to add T7 promoter ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Single colonies were selected for colony PCR with Taq polymerase (Taq 2X Master Mix, NEB, Ipswich, MA, Cat#M0270L), then sent for sequencing for final confirmation ...
-
bioRxiv - Synthetic Biology 2023Quote: ... individual colonies were picked and a colony PCR using Quick-Load Taq 2X Master Mix (New England Biolabs, M0271L) was used to confirm the expected insert size ...