Labshake search
Citations for New England Biolabs :
3751 - 3800 of 9358 citations for Rat Leptin RIA kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... Library preparation was completed using NEBNext Ultra II Directional RNA Library Prep kits (New England Biolabs), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, #E7645S) with NEBNext Multiplex Oligos for Illumina Dual Index Primers Set 1 (NEB ...
-
bioRxiv - Genomics 2023Quote: ... and the pooled library was further quantified using a NEBNext Library Quant Kit (New England Biolabs). The RNA-seq libraries were subjected to two rounds of 75bp paired end sequencing on a NextSeq 550 platform using a 150-cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... and the pooled library was further quantified using a NEBNext Library Quant Kit (New England Biolabs). The CUT&Tag libraries were subjected to 50bp paired end sequencing on a NextSeq 2000 platform using a P2 100-cycle kit (Illumina) ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted 1:100 and used for the ligation using the Quick Ligation Kit (New England Biolabs). Specific base pair substitutions were introduced with site directed mutagenesis by polymerase chain reaction (PCR) ...
-
bioRxiv - Genomics 2023Quote: Sequencing libraries were prepared using NEBNext Ultra II DNA library prep Kit for Illumina (NEB #E7645S) according to the manufacturer’s instructions for MNase ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) to produce stranded cDNA libraries ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA library preparation using NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB), and sequencing was performed at the Yale Stem Cell Center Genomics Core facility ...
-
bioRxiv - Cell Biology 2023Quote: Amplified ssDNA library was purified with the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB). For this ...
-
bioRxiv - Cell Biology 2023Quote: In vitro transcription was done using the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB), following the manufacturer’s instructions for short transcripts ...
-
bioRxiv - Systems Biology 2023Quote: ... Libraries were prepared with the NEBNext Ultra II DNA library preparation kit (New England Biolabs, E7645L), quantified by Qubit fluorimetry ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were prepared using the NEBNext Ultra II DNA Library Preparation Kit (New England Biolabs) and sequenced on Illumina NextSeq500 (75 bp in single-end mode ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were prepared using the NEBNext Ultra II DNA Library Preparation Kit (New England Biolabs) and sequenced on Illumina NextSeq500 platform (75 bp in single-end mode).
-
bioRxiv - Neuroscience 2023Quote: ... and HEK-293 cells were extracted using Monarch Total RNA Miniprep Kit (New England BioLabs, T2010S). To prepare RNA-Seq libraries ...
-
bioRxiv - Systems Biology 2023Quote: ... RNA was synthesised using T7 RNA polymerase (HiScribe T7 High Yield RNA Synthesis Kit, NEB, E2040S). Then RNA was reverse- transcribed using a recombinant Moloney leukemia virus reverse transcriptase (GeneAce cDNA Synthesis Kit ...
-
bioRxiv - Biochemistry 2023Quote: ... RT-PCR reactions were performed using the OneTaq One-Step RT-PCR Kit (New England BioLabs) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... H259A and H353A were cloned using site directed mutagenesis (Q5® Site-Directed Mutagenesis Kit, NEB) using primers TCATACAGCAGCGGTCCAGTTAC (forward ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and cloned into pUC19 (digested with EcoRI plus HindIII) using the NEBuilder kit (New England Biolabs). The cloning products were then transformed into E ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-qPCR was performed with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) according to manufacturer’s instruction on an iQ5 Real-Time PCR System (Bio-Rad) ...
-
bioRxiv - Genetics 2023Quote: ... The library was generated with NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB; 7770), and sequencing was done using the NovaSeq 6000 S4 platform with PE150 ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were constructed using the NEBNext II directional RNA library kit for Illumina sequencing (NEB) and sequenced on a NextSeq2000 platform at the Epitranscriptomics and RNA-sequencing facility ...
-
bioRxiv - Neuroscience 2023Quote: ... single histidine point mutations were generated using the Q5 Site-Directed Mutagenesis kit (New England Biolabs) with DNA oligonucleotides incorporating the mutation ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sik3 and Lkb1 were cloned into pXPR-RFP-Blast using the Gibson Assembly Kit (E2611L, NEB). The target sequences are as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... total RNA isolation was performed by using the Monarch Total RNA Miniprep Kit (New England BioLabs) and RNA concentration was detected in a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2021.9 All three fragments were cloned via Gibson assembly using a HiFi DNA assembly kit (NEB) into a vector backbone containing PiggyBac transposition sites.35 The Cer1:H2B-Venus reporter construct was co-transfected with CAG-pBASE35 using Lipofectamine 2000 (ThermoFisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was derived from total RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB, E6560S). Numerous primers were designed against cryptic exon targets and screened to identify primer pairs that minimized background bands.
-
bioRxiv - Molecular Biology 2023Quote: ... The samples were prepared using a Luna Universal One-Step RT-qPCR Kit (New England Biolabs). Quantitative RT-PCR was performed with an Mx3000P qPCR system (Agilent ...
-
bioRxiv - Molecular Biology 2023Quote: ... va mtSSB ΔMTS by PCR amplification and ligation (Q5 Site-Directed Mutagenesis Kit, NEB, Cat #E0554). The plasmid insert was sequence-verified and then transformed into E ...
-
bioRxiv - Neuroscience 2023Quote: ... The libraries were quantified using the NEBNext Library Quant Kit for Illumina (#E7630; New England Biolabs) based on the mean insert size provided by the Bioanalyzer ...
-
bioRxiv - Neuroscience 2023Quote: ... We quantified the libraries using the NEBNext Library Quant Kit for Illumina (New England Biolabs, #E7630) based on the mean insert size provided by the Bioanalyzer ...
-
bioRxiv - Bioengineering 2023Quote: ... NEBNext Ultra II Directional RNA Library Prep Kit (Catalog # E7760, NEW ENGLAND BIOLABS,MASSACHUSETTS, UNITED STATES), NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Cell Biology 2023Quote: ... FlucWT-HA-GFP11 and FlucDM-HA-GFP11 plasmids were constructed using site-directed mutagenesis kit (NEB) based on FlucSM-HA-GFP11 ...
-
bioRxiv - Cancer Biology 2023Quote: ... the NEBNext Ultra II DNA Library Prep Kit for Illumina was followed (NEB, cat. no. E7645S) using total DNA yield as input material ...
-
bioRxiv - Physiology 2023Quote: ... Samples were reversed transcribed using the LunaScript RT SuperMix Kit (New England BioLabs, Ipswich, Massachusetts, USA) and relative gene expression was quantified via CFX-96 Real-Time PCR Detection System (RRID:SCR_018064 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... library concentrations were quantified with qPCR using the NEBNext Library Quant Kit for Illumina (NEB, E7630S), and pre- and post-selection libraries were combined as two pools ...
-
bioRxiv - Plant Biology 2024Quote: ... The sgRNA was first synthesised using the EnGen sgRNA synthesis kit New England Biolabs (NEB #E3322) before mixing with the Cas9-NLS to form the RNP complex ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA-seq libraries were generated using the NEBNext Ultra Directional RNA Library Prep Kit (NEB, #E7420L), followed by sequencing on an Illumina Hiseq 4000 system ...
-
bioRxiv - Genetics 2024Quote: ... The resulting product was inserted into linearized pKR482 using NEBuilder HiFi DNA assembly kit (NEB E5520S) and transformed into 10-beta cells ...
-
bioRxiv - Synthetic Biology 2024Quote: ... IVT-produced RNA samples were purified using a Monarch® RNA Cleanup Kit (New England Biolabs). ssRNA during RNA extractions was degraded with RNase T1 (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: 7.5ug of total RNA was immunoprecipitated for m6A with EpiMark® N6-Methyladenosine Enrichment Kit (NEB) following the manufacture protocol with 10% of the sample RNA taken as input prior to the pulldown ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... cDNA was synthesized using the ProtoScript II Reverse Transcriptase kit (New England BioLabs, Évry-Courcouronnes, France). qRT-PCR was performed in quadruplets on a CFX384 Touch Real-Time PCR Detection System (Biorad ...
-
bioRxiv - Plant Biology 2024Quote: ... Sequencing libraries were constructed using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2024Quote: ... The SUGCT insert and pcDNA5/FRT vector were ligated by using the Quick Ligation Kit (NEB) and transformed to TOP10 chemically competent cells (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... Sequencing libraries were generated using NEBNext Ultra TM RNA Library Prep Kit for Illumina (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA library preparation was done using NEBNext Ultra II RNA library prep kit (NEB E7770S) as per manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA-seq libraries were then prepared using the NEBNext Ultra II directional RNA library kit (NEB).
-
bioRxiv - Genomics 2023Quote: ... Library prep was performed using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7103) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Sequencing libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, Catalog #E7530L) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Molecular Biology 2023Quote: crRNA (Supplementary Table 2) was synthesized using a HiScribe T7 High Yield RNA Synthesis Kit (NEB). The DNA sequences includes the T7 promoter at the 5’ end and the sequence from crRNA with the target sequence at the 3’ end ...
-
bioRxiv - Molecular Biology 2023Quote: ... The concentration of libraries was determined using NEBNext library Quant kit for Illumina (NEB, Cat# E7630). Libraries were then pooled and sequenced by Macrogen on Ilumina Hiseq X-ten platform ...