Labshake search
Citations for New England Biolabs :
3851 - 3900 of 7437 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... products were purified with the Monarch PCR DNA cleanup kit (NEB, Inc.) and analyzed by endpoint PCR ...
-
bioRxiv - Microbiology 2023Quote: ... purification (Monarch PCR & DNA Cleanup Kit, New England Biolabs Cat. No. T1030), and ligation with T4 DNA ligase (New England Biolabs Cat ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library was prepared with NEBNext High-Fidelity 2X PCR Master Mix (NEB) and SYBR Green I (ThermoFisher) ...
-
bioRxiv - Microbiology 2024Quote: The rsmA gene was PCR amplified using Phusion polymerase (New England BioLabs) according to the manufacturer specifications ...
-
bioRxiv - Microbiology 2024Quote: All PCR reactions were performed using Phusion HF polymerase (New England Biolabs). All oligonucleotides were purchased from Integrated DNA Technologies (IDT) ...
-
bioRxiv - Microbiology 2024Quote: Polynucleotides were synthesized by PCR using Phusion High-Fidelity DNA polymerase (NEB) and locus-specific primers (see Table S2 for sequences) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and amplified using high-fidelity 2X PCR Master Mix (New England Biolabs) using primers with standard ATAC-seq barcodes (Buenrostro et al. ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... the genomic region of interest were firstly amplified by PCR (Q5-NEB), and the products were purified using the DNA Clean & Concentrator kit (Zymo Research) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 25 µl of NEBNext HiFi 2x PCR Master Mix (New England BioLabs) was mixed with 21 µl of the CUT&Tag DNA ...
-
bioRxiv - Microbiology 2024Quote: ... PCR fragments were amplified with the Q5 polymerase (NEB, Ipswich, MA, USA), following the manufacturer’s recommended protocol ...
-
bioRxiv - Genetics 2024Quote: ... PCR amplification was performed with Q5 High-Fidelity DNA Polymerase (NEB M0491S). Following DPN1 digestion ...
-
bioRxiv - Developmental Biology 2024Quote: ... Eluted DNA was amplified using NEBNext Ultra II PCR Master Mix (NEB) and purified using AMPure XP beads ...
-
bioRxiv - Developmental Biology 2024Quote: ... IVT sgRNA products were purified Monarch PCR and DNA Cleanup Kit (NEB) and quantified ...
-
bioRxiv - Genetics 2024Quote: ... We ligated the PCR fragments into the vectors using T4 ligase (NEB), transformed into E ...
-
bioRxiv - Cancer Biology 2024Quote: ... The RRM2 fragments were amplified by PCR using Phusion polymerase (NEB, M0530L) and OriGene clone GC-Z9335-GS as template ...
-
bioRxiv - Immunology 2024Quote: ... TAP-PCR reaction was performed using 5 μL of Q5 polymerase (NEB), 5 μL of GC Enhancer (NEB) ...
-
bioRxiv - Biochemistry 2024Quote: ... Libraries were PCR amplified using Phusion DNA Polymerase (M0530, New England Biolabs). Quality assessment of the libraries and sequencing were performed by the NGS platform of the University of Bern.
-
bioRxiv - Bioengineering 2024Quote: ... PCR products were assembled using NEB Hifi DNA Assembly Master Mix (NEB) according to the manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR was performed using the Q5 High-Fidelity DNA Polymerase Kit (NEB) and primers specific for the microsatellite expansion adapters (1X Q5 Reaction Buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... and a PCR based insert produced by Phusion DNA Polymerase (NEB, #M0530L) containing a second sgRNA cloning site (SbfI) ...
-
bioRxiv - Genomics 2023Quote: ... and amplified using NEBnext High-Fidelity 2x PCR Master Mix (NEB, M0541L) and custom indexed primers68 ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR was performed using Q5 High-Fidelity DNA Polymerase (New England Biolabs) for 20 cycles ...
-
ADEVO: Proof-of-concept of Adenovirus Directed EVOlution by random peptide display on the fiber knobbioRxiv - Bioengineering 2023Quote: PCRs were performed using the Phusion DNA Polymerase (New England Biolabs, #M0530S) following manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 and 3 were assembled by PCR assembly using Vent polymerase (NEB), with each reaction consisting of 1 x ThermoPol buffer ...
-
bioRxiv - Genomics 2023Quote: ... The resulting PCR product was then circularized by treatment with PNK (NEB) and T4 ligase (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was purified using Monarch PCR/DNA Cleanup Kit (New England BioLabs). ChIP-seq libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs ...
-
bioRxiv - Neuroscience 2022Quote: ... qRT-PCR reactions (25μL) contained 12.5μL of Sybr Select or Luna (NEB) Mastermix and 0.25 μM primers ...
-
bioRxiv - Genomics 2022Quote: ... and 20 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541L) were added to each well ...
-
bioRxiv - Microbiology 2022Quote: ... and cleaned up through the Monarch PCR & DNA Cleanup spin columns (NEB). CPER assembly was performed as previously described by combining 0.05 pmol of each fragment in a 50 μL reaction containing 2.5 U PrimeSTAR GXL DNA polymerase (Takara Bio ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR reactions were performed with the Phusion High-Fidelity DNA polymerase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: A PCR amplification using Phusion® High Fidelity DNA Polymerase (NEB, M0530S) was performed on pCW-gna-bilRS with forward primer GAAGTACACGGAGGGGGGCTGATCGGATCATTCTGTTCG and reverse primer GAATGATCCGATCAGCCCCCCTCCGTGTACTTCTATAATATC to amplify the pCW-gna-bilRS plasmid and introduce a mutation of the 166 aspartic acid and 167 arginine to glycines ...
-
bioRxiv - Microbiology 2023Quote: ... A polymerase chain reaction (PCR) amplification using OneTaq Master Mix (NEB, M0482) was performed on C ...
-
bioRxiv - Microbiology 2023Quote: ... Genes were PCR-amplified (New England Biolabs Q5 HotStart 2X Master Mix) from a high-titer Hammy lysate using a forward primer complementary to the first 15-25 bp of each gene sequence (Integrated DNA Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... We performed PCR with the Q5 High Fidelity polymerase (New England Biolabs) to amplify a 1,500 bp region upstream of the start codon of the TgP21 gene (www.toxodb.org accession number TGME49_238440 - Me49 being the reference for cystogenic T ...
-
bioRxiv - Neuroscience 2023Quote: ... All PCR products were amplified using a standard Q5 polymerase protocol (NEB) and purified with an agarose gel extraction kit (Thermo Scientific) ...
-
bioRxiv - Zoology 2023Quote: ... 5 µl consisting of 1x OneTaq® PCR master mix (NEB, USA), 0 ...
-
bioRxiv - Bioengineering 2023Quote: ... The PCR products were treated with a KLD enzyme mix (NEB M0554S), which phosphorylates the 5’ ends of the linearized PCR products ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative PCR was performed with Luna® Universal qPCR Master Mix (NEB). All procedures were carried out according to manufacturer instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... and PCR amplified (Q5 HotStart DNA polymerase (NEB, Cat. No./ID: M0493L)) ...
-
bioRxiv - Genetics 2023Quote: ... PCRs were performed by Q5 High-fidelity DNA Polymerase (New England Biolabs) and PCR products were verified by gel electrophoresis and sequencing (performed by DNA Sequencing and Service ...
-
bioRxiv - Genetics 2023Quote: ... Small RNA libraries were purified with the Monarch PCR Cleanup Kit (NEB) prior to size selection to obtain the correct fragment sizes for small RNA analysis ...
-
bioRxiv - Molecular Biology 2023Quote: ... by PCR with Q5 High-Fidelity DNA Polymerase (New England Biolabs, www.neb.com) polymerase ...
-
bioRxiv - Molecular Biology 2023Quote: ... Digestion of this PCR product with PvuII-HF (New England Biolabs, www.neb.com) distinguished between SICm (PvuII sensitive ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR templates for the dsRNA were prepared using T7 megascript Kit (NEB). dsRNA against bacterial β-galactosidase gene (lacZ ...
-
bioRxiv - Molecular Biology 2023Quote: ... Backbone plasmids were linearised via PCR followed by treatment with DpnI (NEB) before assembly with fragments using NEBuilder HiFi DNA Assembly (NEB ...
-
bioRxiv - Genetics 2023Quote: ... Spin-purified PCR products were digested with BsaI-HF-v2 (R3733; NEB) and the size and integrity of full length and digested PCR products were confirmed on a 4% agarose e-gel (Thermo) ...
-
bioRxiv - Microbiology 2023Quote: ... Phusion High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA, USA) was used for all PCR steps ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 14 PCR cycles using unique dual indexes (New England Biolabs E6440S). Following clean-up with SparQ PureMag beads (QuantaBio) ...
-
bioRxiv - Immunology 2023Quote: ... The PCR product was phosphorylated and ligated with KLD enzyme mix (NEB) before transformation into competent cells followed by sequence verification (1st BASE ...
-
bioRxiv - Molecular Biology 2023Quote: ... All PCR reactions were done using Q5 high-fidelity polymerases (M0493S, NEB), and all constructions and intermediates were generated using a NEBuilder HiFi DNA assembly cloning kit (E5520S ...