Labshake search
Citations for New England Biolabs :
3501 - 3550 of 4002 citations for Hexadecanoic acid reaction products with tetraethylenepentamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: Site-directed mutagenesis of StCphA2 was by performing PCR reactions with 10 ng template in Phusion® HF buffer (NEB), 0.2 mM of each dNTP ...
-
bioRxiv - Biochemistry 2023Quote: ... Around 1μg of DNA was isolated from each reaction using a Monarch PCR & DNA Cleanup Kit (elution volume of 15 μl, NEB). The DNA was treated with 5 U of Antarctic Phosphatase (NEB #M0289S ...
-
bioRxiv - Genomics 2023Quote: ... were PCR-amplified (2 PCR reactions, 12 cycles) using Illumina adapter-specific primers and NEBNext Ultra II Q5 Master Mix (NEB). After library profile analysis by Agilent 2100 Bioanalyser (Agilent Technologies ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... or A3H Hap VII were added to the reactions together with 40 U of murine RNase inhibitor (NEB, Ipswich, Massachusetts). Activity of cell lysates was evaluated in reactions containing 43 nt or 85 nt linear or 21 nt hairpin substrates (Table S3) ...
-
bioRxiv - Genomics 2023Quote: ... we amplified the library using PCR with a 10 µl reaction mixture containing 5 µl of Phusion High Fidelity MASTER Mix (New England Biolabs), 2 µl of P1 primer (AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC G) ...
-
bioRxiv - Cell Biology 2023Quote: ... we quantitated the proportion of abnormal DNA fragments generated by the procedure using DNA prepared from the transfected cell population and a polymerase chain reaction (PCR)-based T7 endonuclease assay (New England BioLabs). The PCR was performed with primers flanking the predicted ligation-junction product (forward primer AGAATACCAGGGGGCCATGA and reverse primer AACGAATCCTTTCCCTGGGTC) ...
-
bioRxiv - Microbiology 2023Quote: ... The reaction mix (2 μL) was then used to transform 25 μL of chemically competent 10-beta cells (C3019H; NEB), which were subsequently plated on Luria-Bertani (LB ...
-
bioRxiv - Genomics 2024Quote: ... 40 fmol of plasmid backbone and 2 μL of each annealed oligo pair were added to a one-pot golden gate reaction with Esp3I and T4 DNA Ligase (NEB) as has been done in previous studies73,75 ...
-
bioRxiv - Genetics 2024Quote: ... Reverse transcription was performed with 1 µg of RNA using one-step reaction using LunaScript RT SuperMix Kit (NEB, #E3010) as indicated by the manufacturer ...
-
bioRxiv - Immunology 2024Quote: ... Donor and destination plasmids were combined in a single digestion-ligation reaction to generate an expression plasmid encoding the heavy and light chains with BsaI-HF (NEB) and T4 ligase (NEB) ...
-
Asymptomatic neonatal herpes simplex virus infection in mice leads to long-term cognitive impairmentbioRxiv - Microbiology 2024Quote: ... qPCR reactions were performed using the following components to a final reaction volume of 20 μl: 1X Luna Universal qPCR Master Mix (New England Biolabs), forward and reverse primers at a final concentration of 0.25 μM ...
-
bioRxiv - Microbiology 2024Quote: ... One micro litter of circularized cDNA was subjected to PCR in a 20 μL reaction mixture composed of 20 U/mL Phusion polymerase (NEB), 1x Phusion GC buffer (NEB) ...
-
bioRxiv - Cell Biology 2024Quote: ... lane profiles were generated in ImageJ for each reaction condition and the molecular weight markers (50 bp ladder, NEB, #N3236). Background was subtracted from each lane profile by subtracting the signal from the equivalent reaction condition (-/+ RNase HII ...
-
bioRxiv - Cell Biology 2024Quote: ... Size-selected DNA fragments were amplified using NEB unique multiplexed i5 and i7 primers (E6440) in a total reaction volume of 100 µl together with 2 U Phusion High-Fidelity DNA Polymerase (NEB) and in the presence of 0.2 mM dNTPs and 1X Phusion High-Fidelity buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... The PCR products were assembled using 75 ng of the backbone PCR DNA and 12.5 ng of the PCR amplified library in a 15 μL Gibson assembly reaction using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) at 50 °C for 1 hr ...
-
bioRxiv - Molecular Biology 2024Quote: ... 190 ng of linearized vector and 13.15 ng of each sub pool were used for each Gibson reaction of 80 µL using HIFI DNA Assembly Master Mix (NEB). The Gibson reaction was incubated for 1 hr at 50°C and DNA was isolated by isopropanol precipitation and transformed into Lucigen Endura Competent Cells according to manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 200 ng of purified product was used in a 20 µL IVT reaction using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs), fully substituting UTP with N1-methylpseudouridine-5’-phosphate (TriLink Biotechnologies ...
-
bioRxiv - Plant Biology 2024Quote: ... These were then simultaneously transferred into a single vector via a Golden Gate level 1 reaction with BsaI (New England Biolabs) and a modified version of pICH4774246 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR reactions were 50 µL final with 200 nM forward and reverse primers with 1x Q5 PCR Master Mix (NEB); 23 cycles of 98°C for 20 seconds ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 µL reactions were prepared by mixing 25 µL of 2× Phusion High-Fidelity PCR Master Mix (New England Biolabs), 5 ng of purified library plasmid DNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... of POLQM1 were amplified off of the plasmid using primers containing a 5’ XbaI site and a 3’ KpnI site: HIS-SUMO RVS KpnI-ATTAGGTACCTCCCGTCTGCTGC HIS-SUMO FWD XbaI-TTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAG PCRs reactions used Phusion High-Fidelity DNA Polymerase (NEB) following manufacturer’s instructions and were run for 30 cycles ...
-
bioRxiv - Plant Biology 2024Quote: ... The ITS region was amplified by polymerase-chain reaction (PCR) using the Phusion High-Fidelity DNA Polymerase (M0530L, New England Biolabs) and the following primers (as reported in (Jaramillo et al ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were incubated for 10 min at 50°C and 1 μL was used as template for a PCR reaction using Phusion DNA Polymerase (M0530S, NEB) as described (ref ...
-
bioRxiv - Genomics 2024Quote: ... To generate libraries 50uL PCR reactions were made using 25uL NEBNext® High-Fidelity 2X PCR Master Mix(NEB #M0541L), 2.5uL of universal Ad1_noMx primer ...
-
bioRxiv - Microbiology 2024Quote: ... Resulting cDNA was next used as input for a quantitative (q)PCR reaction using Luna Universal qPCR Master Mix (New England Biolabs). Cycling conditions were as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µM of sgRNA scaffold and a RPA1-specific forward primer and were mixed in 1× HiFi reaction buffer with MgCl2 and 1 unit Phusion High-Fidelity DNA Polymerase (New England BioLabs), 25 µl total volume ...
-
bioRxiv - Genomics 2024Quote: ... add 0.2 pmol of the preincubated mixture to the RT reaction and follow with the addition of 25 U of EcoP15I (10 U/μL, NEB). Incubate the RT reaction at 37°C for 2 h and then at 85°C for 20 min.
-
bioRxiv - Microbiology 2024Quote: ... Amplification was performed in triplicate 25-μl reactions for each sample with Phusion High-Fidelity Master Mix (New England Biolabs) with 3% dimethyl sulfoxide ...
-
bioRxiv - Microbiology 2024Quote: ... A 20 µL Gibson Assembly reaction was performed with 50 ng of vector at a 2:1 ratio for 1 hour (New England Biolabs NEBuilder HiFi DNA Assembly Master Mix ...
-
bioRxiv - Microbiology 2024Quote: ... And a positive control reaction was performed where lysate was substituted with 2 µL (20 U) of purified Exonuclease I (NEB). Reactions were allowed to incubate for 1 min at room temperature ...
-
bioRxiv - Genomics 2024Quote: ... The SPRI purified template was then put into a 100 µL indexing PCR reaction with 50 µL of NEBNext High-Fidelity 2X Master Mix (NEB) and 0.2 µM each of TruseqP5 forward indexing (OLG_025 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1µM final primer concentration in a 50µl reaction with NEBNext® Q5 Hot Start HiFi PCR Master Mix (NEB, M0543L) cycling at 98°C – 3’ ...
-
bioRxiv - Molecular Biology 2024Quote: ... then 40 μL of each sample was used reactions as outlined in the manufacturer’s protocol for denaturing reaction conditions using the Protein Deglycosylation Mix II Kit (New England Biolabs, P6044) both with and without deglycosylase enzymes ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was diluted 1:10 and used for qPCR reactions employing Luna® Universal qPCR Master Mix (New England Biolabs). Ct values were computed by the instrument and used for calculation of ΔΔCt using ACTB (Beta-actin ...
-
bioRxiv - Cell Biology 2024Quote: ... F and mCh oma-1(378) R (Table S2) and then cloned into pVIG57 (gift of Vincent Galy) using a HiFi reaction (New England Biolabs). The resulting plasmid pCFJ150_Pmex-5:CTPD::mCh::LGG-2 was injected for MosSCI (19 ...
-
bioRxiv - Biochemistry 2024Quote: PamB2-ribosome complexes were generated by in vitro transcription-translation reactions in PURExpress in vitro protein synthesis system (New England Biolabs) with the same reaction mix as described earlier in the toeprinting assays ...
-
bioRxiv - Biochemistry 2024Quote: To prepare the RNA for a MaP-RT reaction with a template switching oligonucleotide (TSO, Table S3) the Vaccinia Capping System (NEB) was used without the addition of SAM to add a guanylate cap (Gcap ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µl of complementary DNA (cDNA) from the MaP reverse transcription reaction was used as template for PCR with Q5 hot-start polymerase (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2024Quote: ... 2 µg of total RNA was circularised in a reaction containing 6 U T4 RNA Ligase 1 (New England Biolabs), 50 µM ATP ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was diluted 1:50 in ddH2O and 2 µL used as a template in a 15 µL reaction using the Luna Universal qPCR Master Mix (NEB) on a Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 30 uL of the purified PCR amplicons were then digested and ligated in a 50 uL one-pot reaction containing 1x T4 ligase buffer (NEB), 20U DpnI (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... The first-strand cDNA was then amplified in a PCR reaction with Phusion High Fidelity PCR Master Mix (New England Biolabs) using BRBV segment-specific primers targeting the segment termini ...
-
bioRxiv - Synthetic Biology 2024Quote: ... including an on-column DNase I digest using 50 µL reactions of DNase I (New England Biolabs, cat. no. M0303). RNA integrity was verified at BGI Tech Solutions (Hong Kong ...
-
bioRxiv - Plant Biology 2024Quote: ... Equal volumes of each indexed amplicon reaction were pooled and subsequently gel-purified using the Monarch DNA Gel Extraction Kit (New England Biolabs). A single Illumina sequencing library was prepared using the xGen DNA Library Prep MC Kit (Integrated DNA Technologies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR reactions were set up in 100 µL as follows using Q5 high fidelity DNA polymerase (New England Biolabs M0491S) following provider specifications ...
-
bioRxiv - Synthetic Biology 2024Quote: Plasmid DNA was pre-digested with the Not I enzyme in a reaction containing 1 μL of CutSmart buffer (NEB), 0.5 μL of NotI-HF enzyme (NEB) ...
-
bioRxiv - Synthetic Biology 2024Quote: Golden Gate cloning reactions were performed using forty fmol of plasmid parts in a reaction mix recipe of 1 µl restriction enzyme (BsmBI-v2, Esp3I, or BsaI-HF-v2) (New England Biolabs), 1.5 µl bovine serum albumin ...
-
bioRxiv - Physiology 2024Quote: ... the following reagents were added to each tube containing 1 cell in ∼5 μL: 2 μL M-MuLV Reverse Transcriptase Reaction Buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2024Quote: ... Five microliters of the ligated DNA (∼100-200 ng) were used in the primary PCR reaction (Q5 Hot Start High-Fidelity 2X Master Mix, NEB) in a 25 μL reaction volume containing 500 nM of oligonucleotide primers (NEO210AS ...