Labshake search
Citations for New England Biolabs :
3301 - 3350 of 4002 citations for Hexadecanoic acid reaction products with tetraethylenepentamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Cellularized blastoderms were individually squashed and then lysed in 10 µL buffer containing Proteinase K and ThermoPol reaction buffer (New England BioLabs) for 45 min at 60°C then 10 min at 95°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was then subjected to a primer extension reaction with dUTP to separate the nascent strand from its complement (1X NEB buffer2 ...
-
bioRxiv - Microbiology 2020Quote: ... All PCR reactions were carried out with 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs); 0.2 μM each of forward and reverse primers ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA copies were quantified in 10% of the obtained eluate volume with a one-step RT-qPCR reaction using a standard curve and the Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs) and previously published TaqMan primers and probe (Corman et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... The supernatant was removed using a magnetic separator and washed once with 1 mL NEBuffer 2 and resuspended in 115 mL of Ligation reaction with Quick Ligase buffer (NEB), 6,000 U of Quick Ligase (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... the ligated DNA was subjected to a Fill-in reaction by resuspending the beads in 40 μL of 1X phi29 buffer (NEB) containing 0.2 mg/mL BSA (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was subjected to λ exonuclease digestion by incubating the beads with 50 μL of λ exonuclease reaction buffer (NEB) containing 0.1% Triton X-100 ...
-
bioRxiv - Molecular Biology 2020Quote: A 3 µL volume of parasite culture or 10 ng of plasmid was used in 25 µL PCR reactions with Phusion High-Fidelity DNA polymerase (NEB). To confirm pMG74PfAUBL insertion into the 3’ UTR of PfAUBL ...
-
bioRxiv - Molecular Biology 2021Quote: ... A volume of 3.5 μl of the Cre reaction was then used for PCR amplification using the high-fidelity enzyme Q5 (NEB, M0530L) as described above.
-
bioRxiv - Cancer Biology 2021Quote: ... For cloning the oligo pool into the appropriate lentiviral backbone the following reaction was set up: 5 μl 10x Cutsmart buffer (NEB), 1 mM DTT (final) ...
-
bioRxiv - Microbiology 2021Quote: ... Library preparation began with the digestion of 1pg–200 ng genomic DNA in a 15-µl reaction using 4 U BcgI (NEB) at 37 °C for 3 h ...
-
bioRxiv - Microbiology 2020Quote: ... using 10 μl of the bead suspension in a 50 μl reaction with NEBNext Ultra II Q5 2x master mix (NEB) and 0.5 μM each Solexa 1GA/1GB primers (Solexa 1GA ...
-
bioRxiv - Cell Biology 2020Quote: ... Four hundred ng of total RNA extracted from pools of 250 mouse oocytes was ligated to 400 ng of P1 anchor primer (5’-P-GGT CAC CTT GAT CTG AAG C-NH2-3’) in a 10-µl reaction using T4 RNA ligase (New England Biolabs) for 30 min at 37°C ...
-
bioRxiv - Systems Biology 2020Quote: ... Open Reading Frames (ORFs) were amplified by polymerase chain reaction (PCR) from the templates indicated in Table S7 using Phusion DNA polymerase (NEB) with Gateway compatible sequences appended to the end of the primers (5’ sequence - gggg aca act ttg tac aaa aaa gtt ggc acc ...
-
bioRxiv - Microbiology 2021Quote: ... The protein was pelleted at 18,000xg for 10 minutes and supernatant was removed before the pellet was resuspended in 50 μL trypsin reaction buffer and 1 μg trypsin (New England Biolabs) added and the suspension incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μL of cell lysate was used as template for a 25 μL PCR reaction using Taq DNA Polymerase with ThermoPol Buffer (NEB). For each mutant ...
-
bioRxiv - Microbiology 2022Quote: ... All primers and synthesized DNA sequences were purchased from Eurofins Genomics and all PCR reactions were performed using Q5 High-Fidelity (New England Biolabs). Stable CRISPR KHNYN HeLa cells expressing CRISPR-resistant KHNYN-GFP ...
-
bioRxiv - Microbiology 2022Quote: ... Designed fragments were PCR-amplified from purified phage A006 or synthetic DNA to yield a total of six DNA fragments per phage genome followed by Gibson assembly at 50°C for 1 h in a total reaction volume of 20 µl (NEBuilder HiFi DNA Assembly Cloning Kit, New England Biolabs). Assembly reactions were carried out with purified DNA fragments to yield synthetic genomes ...
-
bioRxiv - Systems Biology 2022Quote: Expression vectors (SCRIPT 1-4; Supplemental Figure S1) were constructed by a Golden Gate reaction with BsaI (New England Biolabs) using the paired gRNA entry vectors and a destination vector as previously described (Decaestecker et al. ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we added 10 ng of template plasmid to 100 μl of a PCR reaction mix that contains 10 μl of 10×ThermoPol buffer (M0267L, NEB), 2.5 μl of Taq DNA polymerase (M0267L ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We used 5 μL plasmid DNA as template in a 25 μL reaction volume with Q5 polymerase according to the manufacturer’s protocol (NEB # M0491L). Reaction was incubated in a thermocycler with the following program ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were incubated for 45 min at 37°C and then transferred to a tube containing the ligation reaction (160 µL NEB ligation buffer 10X ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 l of the DNA was used in a 50 l PCR reaction with the enzyme Q5 polymerase (New England Biolabs) and the primers Cytb-f AGTCCTAGTGTAATGGAAGCand Cytb-r ATCTTCAACGTGTTTAGCACC (annealing temperature 61.5°C) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the reaction was purified with the Monarch RNA Cleanup Kit (500 micrograms) with elution in 50 µl nuclease-free water (NEB). The quality of the gRNA prep was confirmed by agarose gel electrophoresis and quantified using a NanoDrop One (Thermo Fisher).
-
bioRxiv - Biochemistry 2020Quote: ... Translesion synthesis reactions were prepared by combining the eluted DNA with 100 μl of Thermo Pol Buffer (New England Biolabs), 20 μl of 10 mM dNTPs (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2020Quote: ... DNA fragments were purified from the reaction using a Zymo DNA Clean & Concentrator-5 kit (in-house) and amplified with NEBNext High Fidelity PCR Mix (NEB). Library quality was assessed using a Fragment Analyzer system (Agilent) ...
-
bioRxiv - Developmental Biology 2020Quote: ... We tested all primers using 1uL of genomic DNA from H9 human ES cells in a PCR reaction containing 12.5 uL Phusion High Fidelity PCR Master Mix (NEB, M0531L), 1.25 uL 5 uM forward primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... The T7-gRNA forward primer and the reverse scaffold primer were used in primer extension reaction to synthesized a double stranded DNA fragment by using Q5 High Fidelity-based PCR (New England Biolabs) followed by PCR purification (Qiagen) ...
-
bioRxiv - Systems Biology 2020Quote: ... and at least 1 μg but no more than 5 μg DNA was put into an end-resection reaction (5 U T4 DNA Polymerase, NEB) to remove biotin from unligated ends ...
-
bioRxiv - Developmental Biology 2020Quote: ... 300ng of undigested gDNA and from each restriction reaction were loaded in a 1% agarose gel with molecular weight marker (N3232, NEB). 160V current was applied for 30min in a Midigel tank (370000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 μl cDNA reaction mix was amplified by adding 25 μl of Long Amp Taq 2x Master Mix (NEB-kit), 1.25 μl SR primer for Illumina (NEB-kit) ...
-
bioRxiv - Microbiology 2021Quote: ... targeting the C- or N-terminus of various genes were cloned into the p-HXGPRT-Cas9-GFP plasmid backbone using KLD reactions (New England Biolabs), as previously described (71) ...
-
bioRxiv - Microbiology 2020Quote: ... each reaction tube of 20 μl contained 10 μl of Q5 High-Fidelity 2× Master Mix (New England BioLabs Inc.), 20 pmol of forward and reverse primer ...
-
bioRxiv - Molecular Biology 2021Quote: The broken end linker and anchor linker (IDT) were annealed using T4 DNA Ligase Reaction Buffer (#B0202S, New England Biolabs) to a final concentration of 10 μM ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification was performed using ARTIC network V3 tiled amplicon primers in two separate reactions by Q5 High-fidelity polymerase (NEB). First-round PCR products were purified using Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Microbiology 2020Quote: ... The oligos were annealed and cloned into the PLJR962 plasmid using BsmBI restriction sites in an overnight ligation reaction with T4 DNA ligase (NEB). Following ligation ...
-
bioRxiv - Cancer Biology 2020Quote: ... was stored at 20° C or amplified immediately in 50 μl reactions with high-fidelity 2X PCR Master Mix (New England Biolabs) using a common forward primer and different reverse primers with unique barcodes for each sample ...
-
bioRxiv - Synthetic Biology 2020Quote: ... inverted PgolB promoter with Bxb1 recognition sites and reporter-terminator (GFP-rrnBT1) pair were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (M0491, NEB) in thermal cycler (C1000 Touch ...
-
bioRxiv - Plant Biology 2020Quote: ... and an aliquot containing 10 µg protein was treated with lambda protein phosphatase reaction mix following the instructions of the manufacturer (New England Biolabs) for 1 h at 30°C.
-
bioRxiv - Microbiology 2021Quote: ... All polymerase chain reactions were performed using 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs), 0.2 μM of each forward and reverse primer and 10 ng of DNA template ...
-
bioRxiv - Genomics 2020Quote: ... and half of the DNA was 3’-end labeled for 1 h at 37 °C in a 10-μl reaction containing 6 units of terminal deoxynucleotidyl transferase (New England Biolabs), 0.25 mM CoCl2 ...
-
bioRxiv - Genomics 2021Quote: ... “Fuorf_RNA_adapter” was ligated to the 3’ end of 10 μl of cDNA in a 20 μl reaction at 65 °C for 1 hour using Thermostable 5’ App DNA/RNA ligase (New England Biolabs). The reaction was inactivated at 95 °C for 3 minutes and 2 μl of the reaction was used as a template for PCR for sequencing library generation as described below.
-
bioRxiv - Genetics 2021Quote: ... 20uL of RNP (Cas9 + gRNA) was added to the reaction along with 2uL of Taq polymerase (New England Biolabs, M0273L) and 1.5uL of 10mM dATP ...
-
bioRxiv - Genetics 2021Quote: ... To assess library composition by deep-sequencing a PCR reaction was carried out to add illumina adaptors by using the Phusion High Fidelity DNA Polymerase (NEB), with an annealing temperature of 60°C and 14 cycles (OG125/OG126) ...
-
bioRxiv - Genetics 2020Quote: ... All gene amplification reactions were performed using the Phusion High Fidelity PCR Master Mix with HF Buffer (New England Biolabs). To analyze the non-drive allele ...
-
bioRxiv - Biophysics 2021Quote: ... the corresponding set of specific primers (Table S1) and digestion of the template from the reaction mix with DpnI (New England Biolabs), following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... the coding sequence of Fth1 was PCR-amplified (using ProtoScript II Reaction/Enzyme Mix by New England BioLabs, Ipswich, USA).
-
bioRxiv - Evolutionary Biology 2020Quote: ... The PCR reaction was simplified to include 5 μl NEB Q5 Hot Start High Fidelity Master Mix (New England Biolabs), 1μl of the LCO_mod primer ...
-
bioRxiv - Biochemistry 2021Quote: ... purified RNA was dissolved in 3 μl RNase H reaction mix (1x RNase H buffer [NEB], 40 pmol oligo(dT)12 ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μl RT mastermix (2x reaction buffer, 20 mM DTT, 4U murine RNase inhibitor [NEB], 30 U ProtoScript II Reverse Transcriptase [NEB]) were added ...