Labshake search
Citations for New England Biolabs :
301 - 350 of 10000+ citations for Mouse T Cell Surface Glycoprotein CD8 Beta Chain CD8B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Immunoglobulin heavy and light chain cDNA was amplified using the Q5 High-Fidelity 2X Master mix (NEB) and pooled forward primers that bind the leader sequences of the variable regions and the reverse primers that bind the first exon of the mu and kappa constant regions ...
-
bioRxiv - Bioengineering 2024Quote: All polymerase chain reaction (PCR) amplification steps were performed using Phusion DNA polymerase (NEB, Whitby, Ontario, Canada). Primers used for PCR amplification were ordered from Integrated DNA Technologies (IDT ...
-
bioRxiv - Biochemistry 2024Quote: ... The strep tags were removed by incubating the proteins with 64 units of Enterokinase light chain (BioLabs) in 10 mM Tris ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was isolated from HEK293T cells using Bio Tri RNA reagent (Bio-lab) and mRNA was captured using Oligo d(T)25 magnetic Beads (NEB) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... a flow-focusing device was used to encapsulate individual T cells into emulsification droplets containing lysis buffer and oligo(dT) magnetic beads (New England Biolabs)30 ...
-
bioRxiv - Cancer Biology 2023Quote: Genetic perturbations from CRISPR-RNP were quantified from genomic DNA (gDNA) that was extracted from T cells using QuickExtract Buffer (NEB) according to manufacturer’s recommendation ...
-
bioRxiv - Molecular Biology 2023Quote: ... was isolated from total RNA or crude cell lysates by 2 rounds of affinity chromatography using oligo d(T)25-derivatized magnetic beads (NEB). RNA yields were quantified by ultraviolet (UV ...
-
bioRxiv - Microbiology 2024Quote: ... Polyadenylated RNA was then isolated from the whole-cell RNA using NEB Oligo d(T)25 Magnetic beads (NEB, S1419S) according to the manufacturers protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... The bead-bound protein was incubated with 3 µM SNAP-Surface Alexa Fluor 647 (NEB) for 40-60 min at 4°C (to fluorescently label the protein) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the nuclear extract was incubated with 0.4 μM SNAP-surface 549 (New England BioLabs, #S9112S) or HALO-JF646 (Luke Lavis ...
-
bioRxiv - Biochemistry 2023Quote: ... protein was combined with 1.5x molar excess of SNAP-Surface Alexa488 dye (NEB, Cat# S9129S). SNAP dye labeling was performed in buffer containing 20 mM Tris [pH 8.0] ...
-
bioRxiv - Genomics 2019Quote: ... Using Oligo d(T)25 Magnetic Beads (NEB S1419S), polyA+ RNA from 2.5 μg of total RNA was then enriched and RNA-seq libraries prepared using the Click-seq library preparation method using a 1:35 azido-nucleotide ratio (Jaworski and Routh ...
-
bioRxiv - Cell Biology 2021Quote: ... and oligo d(T)23 primer (New England Biolabs) for transcripts ...
-
bioRxiv - Microbiology 2022Quote: ... using T4 Blunt T/A DNA ligase (NEB M0367L). Transformants were cultured and screened for CDD as described in this work.
-
bioRxiv - Microbiology 2022Quote: ... using T4 Blunt T/A DNA ligase (NEB M0367L). Transformants were cultured and screened for CDD as described in this work.
-
bioRxiv - Genomics 2022Quote: ... The mixture electroporated into 100 μL of 10-beta E.coli (NEB, C3020K, 2kV, 200 ohm, 25 μF) in order to achieve a transformation efficiency equal to 300-times the number of unique oligos sequences (target CFU ...
-
bioRxiv - Immunology 2019Quote: ... The generated cDNA was used as template for amplification of the emact full transcript using the primer pair Emact_Dw x Emact_Up by high fidelity polymerase chain reaction (Phusion, NEB). Resulting amplicons were sub-cloned into the pDrive cloning vector (QIAGEN ...
-
bioRxiv - Cell Biology 2021Quote: ... and the polymerase chain reaction (PCR) was used to amplify DNA fragments with Phusion polymerase (New England Biolabs) of the genomic sequence using a forward primer that starts from 2199 bases upstream of the ATG start codon of zipt-2.3 and a reverse primer that contained the codon preceding the stop codon of zipt-2.3 and the coding sequence of the T7 epitope (MASMTGGQQMG) ...
-
bioRxiv - Immunology 2022Quote: The paired antibody VH/VL chains were cloned into Igγ and Igk expression vectors using T4 ligase (NEB). Antibodies produced from cell culture supernatants were purified immediately by affinity chromatography using recombinant Protein G-Agarose (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... polymerase chain reaction (Q5 High-Fidelity 2x Master Mix and OneTaq, Quick-Load 2X Master Mix, both NEB), PCR clean-up (Monarch PCR and DNA Cleanup Kit ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... followed by a 12-cycle polymerase chain reaction (PCR) using high-fidelity Phusion DNA Polymerase (New England BioLabs). DNA amplification was confirmed using Qubit fluorometry ...
-
bioRxiv - Genomics 2023Quote: ... were amplified by polymerase chain reaction (PCR) with the Phusion High-fidelity DNA Polymerase (New England Biolabs #M0530L), then both amplicons were assembled by Gibson assembly to produce the desired CRISPRoff-mScarletI plasmid.
-
bioRxiv - Biochemistry 2023Quote: ... Polymerase chain reactions (PCRs) were conducted with Q5® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, USA), PCR purifications with the Monarch® PCR & DNA cleanup kit (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: Polymerase chain reactions (PCRs) for cloning purposes were performed using the high fidelity Phusion DNA Polymerase (NEB, France). PCR products were purified with the NucleoSpin PCR Clean Up kit (Macherey Nagel ...
-
bioRxiv - Cell Biology 2023Quote: Polymerase chain reaction (PCR) was performed using the Phusion Hot Start Flex 2X Master Mix (New England Biolabs). Reactions were set up according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Surface biotinylated proteins immobilized on streptavidin agarose beads were denatured in Denaturing Buffer (New England Biolabs) at 100°C for 10 min in accordance with the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2020Quote: ... Cut14-SNAP was stained with 0.2 μM of SNAP-Surface Alexa Flour 647 (New England BioLabs) in PEM buffer for 15 minutes at 25 °C ...
-
bioRxiv - Systems Biology 2022Quote: ... Snap-EGFR was labeled with 0.5 μM Snap-Surface Alexa647 (New England Biolabs GmbH, Frankfurt, Germany) for at least 60’ ...
-
bioRxiv - Genetics 2020Quote: ... following rRNA depletion using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB).
-
bioRxiv - Systems Biology 2023Quote: ... The concentrated ligated products were then transformed into NEB 10-beta Electrocompetent E.coli (New England Biolabs, Ipswitch, MA). Three transformations were performed to increase the yield ...
-
bioRxiv - Molecular Biology 2022Quote: ... oligo-d(T)25-Magnetic Beads (S14195, New England Biolabs) were used ...
-
bioRxiv - Bioengineering 2023Quote: SalI restriction enzyme (NEB cat. no. R0138S/T/L/M)
-
bioRxiv - Bioengineering 2023Quote: T4 DNA Ligase (NEB cat. no. M0202S/T/L/M)
-
bioRxiv - Molecular Biology 2019Quote: Libraries were prepared with NEBNEXT rRNA Depletion kit (human/mouse/rat) and NEBNEXT Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The polymerase chain reaction (PCR) products were amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs, MA, USA) with strict accordance to the manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2019Quote: ... bovis C9.1 gDNA by polymerase chain reaction (PCR) with Phusion High-Fidelity DNA Polymerase (New England BioLabs; Beverley, MA) using primers EAM6 and EAM18 ...
-
bioRxiv - Synthetic Biology 2021Quote: Sub-parts (modules, Supplemental Table 1) were amplified via high-fidelity polymerase chain reaction (PCR) (New England Biolabs #M0491S) using dsDNA templates and ssDNA primers listed in Supplemental Table 2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the circular fragments were amplified by two rounds of polymerase chain reaction (PCR) with Q5-High Fidelity polymerase (NEB). Both PCR rounds begin with an initial denaturation at 98 °C for 30 s ...
-
bioRxiv - Cell Biology 2024Quote: ... or else generated by polymerase chain reaction or gBlock synthesis (IDT) and assembled using HiFi assembly (New England Biolabs) according to the manufacturer’s instructions as shown in Table 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... The Oxiselect Comet Assay Kit (Cell-Biolabs) was used as a reference for the experiment ...
-
bioRxiv - Developmental Biology 2020Quote: ... digested pCFD6 backbone to generate UAS-t::gRNA-twi4x using the NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs, Cat. No: R5520S), following the instructions provided by the manufacturers.
-
bioRxiv - Biophysics 2023Quote: ... Purified SNAP-mDia1 was incubated with 5x excess of SNAP-surface-649 dye (New England Biolabs, USA) overnight at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... Btk-SNAP was combined with a 1.5x molar excess of SNAP-Surface Alexa488 dye (NEB, Cat# S9129S) and incubated overnight at 4ºC ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bands were then extracted and DNA was purified from agarose blocks using beta-Agarase I (New England BioLabs, M0392L) following the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2019Quote: ... Cloning was done in bacterial strain Escherichia coli NEB® 10-beta (New England Biolabs, Frankfurt a. M., Germany) grown at 37 °C in lysogeny broth [47] supplemented with 60 mg L-1 ampicillin (Applichem ...
-
bioRxiv - Cancer Biology 2023Quote: ... Bands were then extracted and DNA was isolated from agarose blocks using beta-Agarase I (New England BioLabs, M0392L) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... PCR-product and linearized vector containing the constant part of IgG1 heavy or kappa/lambda light chain sequences respectively were assembled using Gibson cloning with HiFi DNA Assembly Master Mix (NEB). Cloning was considered successful when sequence identity was >99.5% as verified by the cBASE module of BASE software ...
-
bioRxiv - Biochemistry 2019Quote: ... Precipitated proteins were removed by centrifugation at 14000g for 30 min at 4°C and the remaining soluble protein was incubated with enterokinase light chain (NEB) for 16h at room-temperature as per manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Neuroscience 2021Quote: ... The polymerase chain reaction was performed using a 50 µL master mix consisting of 1x standard Taq buffer (New England Biolabs), LCO1490 primer (0.2 mM) ...