Labshake search
Citations for New England Biolabs :
401 - 450 of 10000+ citations for Mouse T Cell Surface Glycoprotein CD8 Beta Chain CD8B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2022Quote: ... A targeting vector with P2A-CreERT2-T2A-GFP-stop codon-rabbit beta globin polyA sequence flanked by 5’ and 3’ homology arms was generated using NEBuilder HiFi DNA Assembly (NEB) and cloned into a pKO2 backbone plasmid ...
-
bioRxiv - Bioengineering 2024Quote: ... pH = 8 for 16 hours at 56°C followed by 30 minutes at 90°C and an additional digest of 4 units of beta-agarase (M0392S, New England BioLabs) for 1 hour at 65°C to ensure full agarose breakdown ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Neuroscience 2020Quote: Overlapping fragments of the unstable NaV1.1 cassette-3 were amplified in polymerase chain reactions (PCR) using Q5® Hot Start High Fidelity 2x Master mix (New England Biolabs) and the primer pairs listed in Table S1 ...
-
bioRxiv - Biochemistry 2020Quote: ... Novel mutants of Ecm2 were generated using inverse polymerase chain reaction (PCR) with Phusion DNA polymerase (New England Biolabs; Ipswich, MA). All plasmids were confirmed by sequencing.
-
bioRxiv - Microbiology 2021Quote: ... Zip codes were then amplified by polymerase chain reaction (PCR) from 200 ng of DNA template using Phusion ® High-Fidelity (HF) DNA Polymerase (New England Biolabs) in HF Buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... neon-Green and mScarlet, these fragments were amplified by Polymerase Chain Reaction using Phusion® High-Fidelity DNA Polymerase (M0530L, New England Biolabs (NEB)) using 35 cycles with an annealing temperature of 60 °C (see table 2 for list of primers ...
-
bioRxiv - Bioengineering 2022Quote: ... Genes encoding individual components of biosensors were amplified by polymerase chain reaction (PCR) using Q5® High-Fidelity DNA Polymerase (New England Biolabs). Site-directed mutagenesis was performed by QuikChange lightning mutagenesis kit (Agilent ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The genes of interest were amplified by polymerase chain reaction (PCR) using Q5 high fidelity DNA polymerase (New England BioLabs, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA was amplified via polymerase chain reaction (PCR) using the proof reading Phusion® high fidelity (HF) polymerase (Phusion) (New England Biolabs). Reactions were heated to 98 0C for 30 s ...
-
bioRxiv - Biochemistry 2020Quote: ... pCSE2.6-hFc-XP or pCSE2.6-mFc-XP 68 where the respective single chain variable fragment of the antibodies or antigens were inserted by NcoI/NotI (NEB Biolabs) digestion ...
-
bioRxiv - Synthetic Biology 2021Quote: minD,minE and FtsA genes were amplified by standard polymerase chain reaction (PCR) amplified using Phusion High-Fidelity DNA polymerase (New England Biolabs, USA) as previously reported24,30 ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: sgDNA template was generated using gene-specific oligonucleotides and constant oligonucleotide by polymerase chain reaction for 30 cycles using Q5 high fidelity polymerase (NEB, USA). PCR product was further purified using Magbio Hiprep PCR cleanup system (Magbiogenomics ...
-
bioRxiv - Biochemistry 2022Quote: The P562del and Exo+THR mutants were generated on the pET23-P2-D12A-THR (Table S1) background through inverse Polymerase Chain Reactions (iPCR) using Q5® High-Fidelity DNA Polymerase (NEB) following the manufacturer’s instructions in 25 μl reactions with primers p2_thumb_loop_R/DEL1 (Table S2 ...
-
bioRxiv - Neuroscience 2023Quote: ... as wildtype or T205A variant were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity master mix (M0492, New England Biolabs (NEB)) from previous plasmid constructs 16 ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped by polymerase chain reaction (PCR) using isopropanol-precipitated genomic DNA as template and OneTaq DNA polymerase (New England Biolabs, (NEB), #M0480 ...
-
bioRxiv - Biochemistry 2023Quote: ... the MsbA gene (from Escherichia coli genomic DNA) was amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (New England Biolabs, NEB) and subcloned into a modified pCDF-1b plasmid (Novagen ...
-
bioRxiv - Biochemistry 2021Quote: ... Yeast surface display plasmid pJYDC1 (Adgene ID: 162458) and pJYDC3 (162460) were cleaved by NdeI and BamHI (NEB, USA) restriction enzymes ...
-
bioRxiv - Developmental Biology 2022Quote: ... dissected wing imaginal discs were incubated for 10 min at 25°C with SNAP-Surface Alexa Fluor 546 (3.3 μM, from NEB), rinsed and incubated for 15 min with SNAP-Surface Block at 13 μM before fixation and immunolabeling ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: INS-1 832/3-SNAP-GLP-1R cells on Thermanox coverslips (Agar Scientific) were labeled with 2 μM SNAP-Surface-biotin (a gift from Dr Ivan Corrêa Jr, New England Biolabs), and 5 μg/ml NaN3-free Alexa Fluor 488 Streptavidin ...
-
bioRxiv - Microbiology 2024Quote: ... the protein eluted from MonoQ 5/50 GL was incubated with 10 μM SNAP-Surface Alexa Fluor 647 (NEB) for 1 hour at 4°C prior to gel filtration.
-
bioRxiv - Genomics 2019Quote: ... which cuts at T/CATGA (both from New England BioLabs, Ipswich, MA). NcoI has 3 cut sites and BspHI has 1 cut site within the transgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... mRNAs were enriched using Oligo d(T)25 Magnetic Beads (NEB S1419S) following manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Messenger RNA selection was performed using NEBNext Oligod(T)25 beads (NEB) incubated at 65 °C for 5 min followed by snap-chilling at 4 °C to denature RNA and facilitate binding of poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... Clean RNA was first rRNA depleted using the NEBNext rRNA depletion kit (Human/Mouse/Rat) (NEB) before being prepared for sequencing using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Ribosomal RNA was removed using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs) according to the manufacturer’s instructions with 6 µl total RNA used as input per sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were prepared using the NEBNext rRNA Depletion Kit v2 (Human/ mouse) (NEB #E7405), NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760 ...
-
bioRxiv - Genetics 2019Quote: ... coli was performed using DH5-alpha or its commercial derivative NEB 10-Beta (New England Biolabs product number C3019I or C3020). Genomic DNA of BY4741 ...
-
bioRxiv - Microbiology 2021Quote: ... coli NEB 10-beta via the heat shock method of transformation according to the manufacturer’s instructions (New England Biolabs, Tokyo, Japan). All plasmids were extracted using the QIAprep Spin miniprep kit (QIAGEN ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The mixture was then returned to ice for 5 minutes before 180 μL of NEB® 10-beta/Stable Outgrowth Medium (B9035, NEB) was added ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR amplified products and cloning vector (pcDNA3.1) were digested to create compatible sites for ligation and transformed into NEB10 beta competent bacteria (NEB, Cat# C3019H). To create plasmids for chick electroporation ...
-
bioRxiv - Molecular Biology 2023Quote: ... The tube containing the plugs was then cooled to 42°C before adding 5 µl of Beta-Agarase I (New England Biolabs, M0392) and incubating at 42°C for 1 hour ...
-
bioRxiv - Physiology 2020Quote: ... Membranes were washed with TBS-T and then incubated with an anti-rabbit horseradish peroxidase conjugated secondary antibody (New England Biolabs, 1:10,000 in 5% skim milk in TBS-T) for 2h ...
-
bioRxiv - Molecular Biology 2020Quote: ... the desired sequences pertaining to the truncated forms of the N protein were subcloned from the synthetic gene using polymerase chain reaction (Phusion polymerase, New England Biolabs, Hertfordshire, UK). All genes were cloned into the modified pet28 vector and gene sequences were confirmed by Sanger Sequencing.
-
bioRxiv - Neuroscience 2022Quote: ... and VL in the vector pCSL3l/pCSL3k (light chain lambda/kappa)41 adapted for Golden Gate Assembly procedure with Esp3I restriction enzyme (New England Biolabs, Frankfurt, Germany). Expi293F cells were cultured at 37°C ...
-
bioRxiv - Genetics 2022Quote: ... The pBSMVγPDS plasmid and all plasmids expressing BSMV γ chain carrying sgRNAs were linearized with BssHII (New England BioLabs, catalog number R0199S). In vitro transcription was performed in 20 µL reaction volume using HiScribe™ T7 High Yield RNA Synthesis Kit (New England BioLabs ...
-
bioRxiv - Immunology 2020Quote: ... The heavy and light chain PCR products were cloned in frame with seamless cloning using the NEBuilder® HiFi DNA Assembly Master Mix (NEB, UK) after linearizing the vectors with KpnI (5’ ...
-
bioRxiv - Microbiology 2023Quote: ... and was subsequently inserted into a cloning vector pUCNDVH5 (28) by Phusion polymerase chain reaction (Finnzymes Phusion®, New England Biolabs®) (29) ...
-
bioRxiv - Biophysics 2021Quote: ... 1mM DTT) were put on ice and mixed with SNAP-tag fluorophores (SNAP-Surface 549 purchased from New England Biolabs) dissolved in DMSO and 0.1% Tween-20 ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were labelled with 2.5 μM (0.5 μM for dSTORM imaging) SNAP-Surface Alexa Fluor 546 or 647 (indicated as SNAP546 and SNAP647 in this study) (NEB) for 20 min and optionally counterstained with 1 μg/ml DAPI (4’,6-diamidino-2-phenylindole ...
-
bioRxiv - Cell Biology 2022Quote: INS-1 832/3 EV and g1-2 cells transiently expressing the SNAP-GLP-1R were labelled at 37°C with 1 μM of SNAP-Surface 649 fluorescent substrate (S9159S, New England Biolabs) in full media prior to treatment with 100 nM exendin-4 or vehicle for 3 hours ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM of purified protein was combined with 2 mM DTT and 10 mM SNAP-Surface Alexa Fluor 546 (New England Biolabs) in PBS for 60 min at 30°C ...
-
bioRxiv - Neuroscience 2021Quote: ... the cells were labeled with 1.5 µM benzylguanine (BG)-LD555 (Gutzeit et al., 2019) (Qinsi et al., 2017) or SNAP-Surface Alexa Fluor 546 (New England BioLabs) in extracellular solution at 37°C for 45 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were labelled by replacing complete growth medium with 500 μl serum free DMEM/F12 containing 200 nM SNAP Surface Alexa Fluor-488 (New England Biolabs) and were incubated for 30 min at 37°C with 5% CO2 ...
-
bioRxiv - Biophysics 2023Quote: ... 24 hrs post-transfection cells were prepared for experiments by labeling tem with 1 µM BG-Surface Alexa 546 (non-permeable dye, New England BioLabs) for 30 min at 37°C in a media containing (in mM) ...
-
bioRxiv - Immunology 2022Quote: ... plates were washed 3 times with PBS-T and TMB substrate (Denovo Biolabs) was added for development of color ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was digested with Msel (T^TAA; New England Biolabs, Ipswich, MA, USA) and ligated to adapters containing a sample identifier sequence ...
-
bioRxiv - Genomics 2020Quote: ... mRNA was enriched with Oligo d(T)25 Magnetic Beads (New England Biolabs) and fragmented by heating at 94 °C for 3 min in 5× First Strand Buffer (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 15 µl of Oligo d(T)25 Magnetic Beads (S1419S, New England Biolabs), were combined with 50 µl of binding buffer (20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Genomics 2021Quote: ... samples were incubated with 20 μl Oligo d(T) Magnetic Beads (NEB, S1419S) in PCR strips for selection of polyadenylated (poly(A) ...