Labshake search
Citations for New England Biolabs :
201 - 250 of 10000+ citations for Mouse T Cell Surface Glycoprotein CD8 Beta Chain CD8B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... or else generated by polymerase chain reaction and HiFi assembly (New England Biolabs) according to the manufacturer’s instructions:
-
bioRxiv - Cell Biology 2024Quote: ... or else generated by polymerase chain reaction and HiFi assembly (New England Biolabs) according to the manufacturer’s instructions:
-
bioRxiv - Genomics 2021Quote: ... gDNA was extracted from 1 ml of overnight culture with the kit Monarch HMW DNA Extraction kit (T#3060 New England Biolabs; Ipswich, MA, USA) following the manufacturer instructions for High Molecular Weight DNA extraction from gram-negative bacteria ...
-
bioRxiv - Genomics 2024Quote: Experiments in T-47D and LNCaP cells were conducted using restriction enzyme MboI (New England Biolabs). Crosslinked chromatin was sonicated using Covaris E220 with the settings of fill level=10 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2019Quote: ... Poly-d(T) beads (NEB #S1419S) were washed twice with 100 μL wash and bind buffer (20 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Genomics 2020Quote: ... oligo d(T)23VN primer (NEB) was annealed to template RNA ...
-
bioRxiv - Genetics 2022Quote: ... and exonuclease T (NEB, catalog # M0625). Blunt ends were A-tailed and capped with END-seq adaptor 1 ...
-
Neuron-astrocyte metabolic coupling facilitates spinal plasticity and maintenance of persistent painbioRxiv - Neuroscience 2022Quote: ... and Oligod(T)23VN (NEB, S1327) following the manufacturer’s instruction for SuperScript First-Strand Synthesis System (Thermo Fisher).
-
bioRxiv - Molecular Biology 2024Quote: ... and exonuclease T (NEB, catalog # M0625). Blunt ends were A-tailed and capped with END-seq adaptor 1 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli K-12 strain NEB DH-10 Beta (New England Biolabs, MA, USA) unless stated otherwise ...
-
bioRxiv - Molecular Biology 2021Quote: ... and transformed into NEB 10-beta electrocompetent E.coli (New England BioLabs Cat. #3020). DNA was extracted using a Qiagen Plasmid Midi Kit (Qiagen Cat ...
-
bioRxiv - Microbiology 2022Quote: pWR1566 was purified from laboratory E.coli strain NEB 10-beta (New England Biolabs) and used to transform V.cholerae strain WR2700 using electroporation ...
-
bioRxiv - Genetics 2023Quote: ... and transformed into NEB 10-beta electrocompetent E.coli (New England BioLabs Cat. #3020). Plasmids were purified using a Qiagen Plasmid Midi Kit (Qiagen Cat ...
-
bioRxiv - Systems Biology 2023Quote: ... The transformation into NEB 10-beta electrocompetent E.coli (New England Biolabs, Ipswitch, MA) was performed slightly differently ...
-
bioRxiv - Cell Biology 2022Quote: ... INS-1 832/3 SNAP- GLP- 1R or SNAP-GIPR cells were labelled in suspension with 40 nM SNAP- Lumi4- Tb and 1 mM SNAP- Surface 649 (New England Biolabs, Hitchin, UK) for 1 hr at room temperature in complete medium ...
-
bioRxiv - Cancer Biology 2022Quote: ... AAK1(S-676D/E/A) and UVRAG (T-518D/E/A) using Q5-site directed mutagenesis Kit (NEB). Manufacturer’s instructions for mutagenic primer design were followed ...
-
bioRxiv - Biophysics 2020Quote: ... The fluorescent probe SNAP-Surface Alexa Fluor 546 (#S9132S) was from NEB Biotech ...
-
bioRxiv - Cell Biology 2019Quote: ... Shi-SNAP was labeled fluorescently with SNAP-Surface 488 (New England Biolabs), and Shi-SNAP-Surface 488-mediated actin bundles were visualized by TIRF imaging ...
-
bioRxiv - Cell Biology 2020Quote: ... and then labeled with SNAP-surface-549 (New England Biolabs, Ipswich, MA) overnight at 4°C following the manufacturers’ protocols ...
-
bioRxiv - Biochemistry 2020Quote: ... by SDS-PAGE after labeling with SNAP-Surface 549 (New England Biolabs). The strains had doubling times similar to their parental strains YF702 or YF4 (Fig ...
-
bioRxiv - Biophysics 2024Quote: ... SNAP-Surface Alexa Fluor 647 (catalog no. S9136S) was obtained from NEB. 40 nm and 90 nm diameter gold nanoparticles (catalog no ...
-
bioRxiv - Microbiology 2024Quote: ... beads were incubated with 10 μM SNAP-Surface Alexa Fluor 488 (NEB) for 1 hour at 4°C prior to elution ...
-
bioRxiv - Immunology 2021Quote: ... gBlocks were amplified by polymerase chain reaction (PCR) using Q5 polymerase (New England BioLabs) following the manufacturer’s protocol ...
-
Imaging of Morphological and Biochemical Hallmarks of Apoptosis with Optimized Optogenetic ActuatorsbioRxiv - Biochemistry 2019Quote: The Cry2(1-531) gene was amplified by polymerase chain reaction (NEB Q5 polymerase) from the full length Cryptochrome-2 gene using a forward primer encoding an XhoI-restriction site with the sequence ...
-
bioRxiv - Genetics 2019Quote: ... the desired concentration for the PCR (Polymerase Chain Reaction) protocol (New England Biolabs Inc.).
-
bioRxiv - Cell Biology 2022Quote: ... were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA polymerase (NEB) and digested using NotI ...
-
bioRxiv - Synthetic Biology 2023Quote: Polymerase Chain Reaction (PCR) was performed using Q5 High Fidelity 2X Master Mix (NEB) with primers synthesized by Integrated DNA Technologies (IDT ...
-
bioRxiv - Molecular Biology 2023Quote: ... Polymerase chain reaction (PCR) was performed with Q5-HF polymerase (New England Biolabs, USA) or with CloneAmp Hifi polymerase (Takara Bio ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were incubated with 200 nM SNAP-Surface® Alexa Fluor® 488 (New England Biolabs, UK, diluted in serum-free DMEM/F12), for 30 min at 37°C with 5% CO2 ...
-
bioRxiv - Genomics 2024Quote: ... 975 μL of pre-warmed 10-beta/Stable Outgrowth Medium was added (NEB #B9035) to each cuvette ...
-
bioRxiv - Cancer Biology 2020Quote: ... Briefly the key stages of this protocol included the purification of PolyA containing mRNA molecules using poly-T oligo attached magnetic beads from 1μg total RNA (via the Magnetic mRNA Isolation Kit from NEB), a fragmentation step using divalent cations under elevated temperature to obtain approximately 300bp pieces ...
-
bioRxiv - Cancer Biology 2021Quote: ... the purification of PolyA containing mRNA molecules using poly-T oligo attached magnetic beads from 1μg total RNA (with the Magnetic mRNA Isolation Kit from NEB), a fragmentation using divalent cations under elevated temperature to obtain approximately 300bp pieces ...
-
bioRxiv - Molecular Biology 2021Quote: ... ExRai AMPKAR T/A was generated via Gibson Assembly using NEBuilder HiFi DNA Assembly Kit (New England Biolabs E2621) using primers 1-2 ...
-
bioRxiv - Microbiology 2021Quote: ... 50 pmol Oligo d(T)23 (NEB) and 10 pmol Deoxynucleotide Triphosphate Mix (Promega) ...
-
bioRxiv - Cell Biology 2020Quote: ... Magnetic oligo-d(T) beads (NEB, S1419S) were equilibrated in NLB and added to the enrichments ...
-
bioRxiv - Neuroscience 2019Quote: ... 1 µM NGFR121W-SNAP was coupled with 3 µM BG549 surface (NEB # S9112) for 1 hour at 37°C in calcium imaging (CIB ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein amounts of OP18 and beta-actin were quantified using a primary stathmin polyclonal antibody (1:1000; Cell Signaling Technology, NEB GmbH, Frankfurt/Main, Germany) and a polyclonal beta-actin antibody (1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... Polymerase chain reactions (PCR) were performed using Phusion High-Fidelity DNA Polymerase (New England Biolabs), and gel-purified products (hph and the gene of unknown function with 73% homology to an AAC(2’)-IIa resistance gene ...
-
bioRxiv - Microbiology 2019Quote: ... Polymerase Chain Reaction (PCR) was conducted following standard conditions outlined by New England Biolabs (NEB) (Ipswich ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μL proteoliposomes were mixed with 8 units of enterokinase light chain (New England Biolabs) and diluted to 20 μL ...
-
bioRxiv - Biophysics 2020Quote: ... tinctorius Nav1.4 genes by polymerase chain reaction (PCR) using Phusion® HF (New England Biolabs). PCR products were gel extracted and sequenced to determine the full-length P ...
-
bioRxiv - Synthetic Biology 2021Quote: ... all linear polymerase chain reaction (PCR) products (Q5 High-Fidelity DNA Polymerase, New England Biolabs) were extracted by gel extraction and then ligated using NovoRec plus One step PCR Cloning Kit (Novoprotein) ...
-
bioRxiv - Zoology 2023Quote: ... Polymerase chain reaction (PCR) was performed using LongAmp Taq 2X Master Mix (New England Biolabs) and previously described primers GLU (5’ GACTTGAAGAACCACCGTTG 3’ ...
-
bioRxiv - Cell Biology 2023Quote: Human ARHGAP18 constructs were created using Polymerase Chain Reaction (PCR) using New England Biolabs (NEB) Phusion High-Fidelity PCR Kit (catalog no ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-myc (NEB/Cell Signaling, 2276; 1:1500) o/n at 4 °C ...
-
bioRxiv - Immunology 2022Quote: ... the purification of PolyA containing mRNA molecules using poly-T oligo attached magnetic beads from 100ng total RNA (with the Magnetic mRNA Isolation Kit from NEB), a fragmentation using divalent cations under elevated temperature to obtain approximately 300bp pieces ...
-
bioRxiv - Molecular Biology 2022Quote: ... PolyA + fraction was isolated from 4.5 μg of DNAse-treated total RNA using NEBNext Oligo d(T)25 Magnetic beads kit (NEB, USA), according to manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...