Labshake search
Citations for New England Biolabs :
151 - 200 of 10000+ citations for Mouse T Cell Surface Glycoprotein CD8 Beta Chain CD8B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... or SNAP-Surface Alexa Fluor647 (New England Biolabs S9136S), respectively ...
-
bioRxiv - Biophysics 2020Quote: ... permeabilised and stained with the SNAP-Surface AlexaFluor647 (NEB) at 4 µM for 1 hour ...
-
bioRxiv - Biophysics 2022Quote: ... SNAP-Surface Alexa Fluor 647 (S9136S, New England Biolabs), SNAP-Surface ATTO488 (S9124S ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 8 µM BC-647 (CLIP-Surface 647, NEB) in a base solution of Passive Lysis Buffer was rotated overnight at 4°C to label CLIP-tagged proteins ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 μM of SNAP-Surface Alexa Fluor 647 (NEB) was added and incubated for another 30 min on ice to saturate the remaining SNAP-tag binding sites ...
-
bioRxiv - Cell Biology 2023Quote: ... we quantitated the proportion of abnormal DNA fragments generated by the procedure using DNA prepared from the transfected cell population and a polymerase chain reaction (PCR)-based T7 endonuclease assay (New England BioLabs). The PCR was performed with primers flanking the predicted ligation-junction product (forward primer AGAATACCAGGGGGCCATGA and reverse primer AACGAATCCTTTCCCTGGGTC) ...
-
bioRxiv - Microbiology 2022Quote: ... the template chain was digested using DpnI restriction endonuclease (NEB, USA). Afterward ...
-
bioRxiv - Molecular Biology 2020Quote: ... Polymerase chain reactions (PCRs) were performed using Phusion DNA polymerase (NEB) according to manufacturer’s protocols ...
-
bioRxiv - Microbiology 2022Quote: Polymerase chain reaction (PCR) was performed with Phusion DNA polymerase (NEB) in a total volume of 50 µl in GC buffer containing 10% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Molecular Biology 2022Quote: ... following the manufacture’s protocol. Plasmids were transformed in DH5-alpha or DH10-beta chemo-competent Escherichia coli (E. coli) cells (New England Biolabs). Transformed bacteria were grown in LB medium supplemented with 50 μg/mL kanamycin or 100 μg/mL carbenicillin ...
-
bioRxiv - Microbiology 2023Quote: ... The reaction mix (2 μL) was then used to transform 25 μL of chemically competent 10-beta cells (C3019H; NEB), which were subsequently plated on Luria-Bertani (LB ...
-
bioRxiv - Microbiology 2023Quote: ... Additional mutations/deletions were introduced in gp140-T/F07 using site directed mutagenesis kit (NEB). The sequences of the recombinant clones were verified through sequencing (Retrogen ...
-
bioRxiv - Microbiology 2022Quote: ... Reverse-transcription polymerase chain reaction (RT-PCR) was performed using the Luna Universal Probe One-Step RT-qPCR kit (New England BioLabs; https://www.neb.ca). The 5 ‘ untranslated region (UTR ...
-
bioRxiv - Cell Biology 2021Quote: ... were performed by confocal microscopy in cells previously labelled with the indicated SNAP-Surface fluorescent probe (New England Biolabs) using a Zeiss LSM-780 microscope with a 63X / 1.4 NA oil objective from the FILM Facility ...
-
bioRxiv - Cell Biology 2024Quote: ... washed and incubated with T cell medium containing 5 μM (Snap-Cell Block S9106S, New England Biolabs, NEB) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... washed and incubated with T cell medium containing 5 μM (Snap-Cell Block S9106S, New England Biolabs, NEB) for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... lysate volume equivalent to 20-40 µg total protein was first denatured at 100°C for 10 min in 1X glycoprotein denaturation buffer (NEB). Endo H digestion was performed at 37°C for 1h in the presence of 1X GlycoBuffer 3 and 1 µL of Endo H enzyme (NEB) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 40 – 50 µg of protein lysate from each sample was denatured in 1X Glycoprotein Denaturing Buffer (Cat.#B1704S; New England Biolabs) with 20 µL total volume at 100°C for 10 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... and transformed into NEB 10-beta Competent E.coli (NEB, Ipswich, MA). Colonies positive for the Lgals3-R200S allele by PCR were grown overnight at 37 °C with nutation at 200 rpm ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... coli K-12 DH10B (Neb 10-beta, NEB catalogue no. C3019H), E ...
-
bioRxiv - Microbiology 2020Quote: ... and the assembly reaction used to transform E.coli (NEB 10 beta). Colonies positive by PCR screening using primers that flank the cloning site were sequenced across the entire S coding region and a single positive isolate adopted for all further manipulations.
-
bioRxiv - Microbiology 2021Quote: Escherichia coli (NEB® 10-beta Electrocompetent E. coli or NEB® 5-alpha Competent E ...
-
bioRxiv - Microbiology 2021Quote: ... were cloned into the pCR-Blunt-II vector using the PCR Blunt Topo kit according to the manufacturer’s instructions and transformed into 10-beta CaCl2-chemically competent bacteria (originally NEB, generated in-house). Following amplifications of colonies and purification of plasmids using a QiAprep Mini kit (Qiagen) ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 µM of SNAP-Surface Alexa Fluor 647 (NEB) in extracellular buffer for 30 minutes at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... The benzylguanine (BG)-conjugated AF647 (SNAP-Surface; NEB; cat.# S9136S) was diluted to 1 μM in blocking solution (0,5% (w/v ...
-
bioRxiv - Biophysics 2023Quote: SNAP-Surface BG-AF647 (New England Biolabs, cat. no. S9136S)
-
bioRxiv - Molecular Biology 2021Quote: ... Complementary DNA (cDNA) was generated by reverse transcriptase polymerase chain reaction (PCR) using the ProtoScript® II First Strand cDNA Synthesis Kit (NEB, Ipswich, MA). Transcript levels were measured by real time PCR using SYBR green on an ABI 7500 system ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Polymerase chain reactions were performed with Q5 DNA Polymerase (NEB, Ipswich, MA). pSMART-HC-Kan (Lucigen ...
-
bioRxiv - Microbiology 2023Quote: ... A polymerase chain reaction (PCR) amplification using OneTaq Master Mix (NEB, M0482) was performed on C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and subsequently cloned in to the pMini-T plasmid using the PCR Cloning Kit (NEB #E1202). Plasmids were extracted from E.coli JM109 transformed cells using the QIAprep Spin Miniprep Kit (Qiagen ...
-
bioRxiv - Biophysics 2022Quote: SNAP-tag labeling of SNAP-mGluR2 was done by incubating cells with 2 µM of SNAP-Surface Alexa Fluor 549 (NEB) and 2 µM of SNAP-Surface Alexa Fluor 647 (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... cells were labeled for 30 min at 37° C with 1 µM Surface BG-Alexa546 (impermeable dye; New England Biolabs) for SNAP in extracellular buffer (EX ...
-
bioRxiv - Genomics 2022Quote: ... OMNI ATAC-Seq was performed as previously described with 320,000 human CD4+ T cells (in total) in batches of 100,000 cells per reaction (NEB #M0544S).(26 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 4.375 U RNase T (NEB), 1.875 U XRN-1 (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... 20µg of protein lysates and media samples were incubated with glycoprotein denaturation buffer at 95°C for 10 min and treated with 0.3µl Endo H (NEB; Catalog no #P0702) enzyme in glyco-buffer 3 for one hour at 37°C ...
-
bioRxiv - Bioengineering 2019Quote: ... eukaryotic recombinant Stlac2 was denatured with Glycoprotein denaturing buffer at 100 °C for 10 min to be deglycosylated using PNGase F (NEB, USA) according to instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were first denatured with Glycoprotein Denaturing Buffer at 65°C for 15 min and then treated with Endoglycosidase H (Endo H) (New England Biolabs, #P0702S) or Peptide-N-Glycosidase F (PNGase F ...
-
bioRxiv - Cell Biology 2022Quote: ... HHV6A BAC DNA was electroporated into JJhan T cells using Lonza (NEB, New Brunswick, MA). When the cells in the transfected culture reached 80% GFP+ ...
-
bioRxiv - Genetics 2019Quote: ... coli strains NEB10®-beta (New England BioLabs Inc., Ipswich, MA, USA), and XL1-blue (Agilent Technologies ...
-
bioRxiv - Genetics 2019Quote: ... and transformed into high efficiency 10-beta competent E.coli (New England BioLabs) to generate pDestTol2pA2_ubi:f5-p2A-EGFP ...
-
bioRxiv - Synthetic Biology 2021Quote: ... NEB 10-beta/Stable Outgrowth Medium (450 μL; B9035S, New England Biolabs) was added to each aliquot and the mixture was shaken vigorously (1250 rpm ...
-
bioRxiv - Immunology 2023Quote: ... was generated by reverse transcriptase polymerase chain reaction (PCR) using the ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich, MA, USA). Transcript levels were measured by real time PCR using SYBR green on an ABI 7500 system ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were washed in PBS-T and blocked in PBS-T + 2% BSA (NEB, B9000) + 5% donkey/goat serum (Jackson Immunoresearch/Dianova ...
-
bioRxiv - Immunology 2022Quote: ... 5 mol% labelled with SNAP-Surface Alexa Fluor 488 (NEB, S9128S), to 25% v/v HeLa lysate in a final volume of 20 µl (50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2022Quote: ... and CLIP-tag ligands (CLIP surface 647 - BC 647 [NEB, S9234S]) at final concentrations of 1 μM in 0.3% PBT ...
-
bioRxiv - Biochemistry 2023Quote: ... and SNAP-Surface® Alexa Fluor® 647 (New England Biolabs). Protein (5 µM ...
-
bioRxiv - Synthetic Biology 2020Quote: ... BG-fluorescein or BG-biotin conjugates (known as “SNAP-Surface® 649”, “SNAP-Cell® Fluorescein” and “SNAP-Biotin” respectively, NEB, at a 1:500 dilution ...
-
bioRxiv - Microbiology 2022Quote: Eight units of enteropeptidase light chain (New England Biolabs, 16 units per µL) and 25 µg of Esp743 (50 µg/µL ...
-
bioRxiv - Microbiology 2020Quote: Polymerase chain reaction (PCR) was performed using Q5 DNA polymerase (New England Biolabs). For cloning ...