Labshake search
Citations for New England Biolabs :
301 - 350 of 4746 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... Genotyping was performed with Quick-Load Taq 2X Master Mix (M0271L, BioLabs), on 2% agarose gel for the PCR bands ...
-
bioRxiv - Neuroscience 2021Quote: ... The Luna universal qPCR Master mix (New England BioLabs, M3003L) was prepared according to the manufacturer’s instructions with a reaction volume of 10µL ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was mixed with Luna Universal qPCR Master Mix (NEB). RpL32 (rp49 ...
-
bioRxiv - Cell Biology 2021Quote: ... or with Luna Universal qPCR Master Mix (New England Biolabs) on a CFX Connect Real-Time PCR Detection System (BioRad) ...
-
bioRxiv - Bioengineering 2022Quote: ... The Luna Universal qPCR Master Mix (New England Biolabs, M3003X) was used to monitor cDNA amplification ...
-
bioRxiv - Microbiology 2023Quote: ... using Luna Universal qPCR Master Mix (New England Biolabs, USA) and gene specific primers (Supp Table 4) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Luna Universal qPCR Master Mix (M3003X; New England Biolabs). The qPCR primer sequences were as follows (5’-3’) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Luna Universal qPCR Master Mix (M3003X; New England Biolabs). The qPCR primer sequences for the detection of PU.1 binding region were as follows (5’-3’) ...
-
bioRxiv - Plant Biology 2024Quote: ... the Luna® Universal qPCR Master Mix (New England Biolabs) was used ...
-
bioRxiv - Microbiology 2023Quote: ... and Luna Universal qPCR Master Mix kit (New England Biolabs). Reactions were performed as technical replicates within each of three biological replicates ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR was thereafter performed using Lunascript Universal qPCR Master Mix (New England Biolabs, M3003) with manufacturer’s suggested reaction conditions ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed with Luna Universal qPCR Master Mix (New England Biolabs #M3003) per the manufactures instructions on a CFX Connect instrument (Bio-Rad #1855200) ...
-
bioRxiv - Cancer Biology 2022Quote: ... qPCR samples were prepared with Luna Universal qPCR Master Mix (M3003, New England Biolabs) and analysed using a Step One Plus Instrument (Applied Biosystems ...
-
A conserved isoleucine in the binding pocket of RIG-I controls immune tolerance to mitochondrial RNAbioRxiv - Immunology 2022Quote: ... SncmtRNA qPCR was performed using Luna® Universal qPCR Master Mix (New England Biolabs). Primetime® Mini qPCR Assay FAM/ Iowa Black FQ labeled (Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2023Quote: Analysis by qPCR was performed using the Luna Universal qPCR Master Mix (NEB; M3003X) and analyzed on an AriaMx Real-Time PCR instrument (G8830A) ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR was thereafter performed using Luna Universal qPCR Master Mix (New England Biolabs, M3003) with manufacturer’s suggested reaction conditions.
-
bioRxiv - Molecular Biology 2023Quote: ... qPCR was performed using the Luna Universal qPCR Master Mix (M3003X; NEW ENGLAND Biolabs) on a Bio-Rad CFX96 Touch fluorescence quantitative PCR instrument ...
-
bioRxiv - Bioengineering 2024Quote: ... qPCR reactions were set up using the Luna Universal qPCR Master Mix (NEB M3003S). Reactions included 6 µL of Luna Mastermix ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantitative PCR (qPCR) was performed using LUNA Universal qPCR Master Mix (New England Biolabs) on the 7500 real-time PCR machine (Applied Biosystems) ...
-
bioRxiv - Genomics 2021Quote: ... Tagmented DNA fragments were amplified by adding 12 µL PCR master mix composed of 11 µL Q5 High-Fidelity 2x Master Mix (New England Biolabs, #M0492) and 0.5 µL each of 10 mM Nextera i5 and i7 index primers ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR was performed in 20 µL reactions using Luna qPCR Universal qPCR Master Mix (New England Biolabs), 5 ng of cDNA as template ...
-
bioRxiv - Microbiology 2020Quote: ... A custom-made SYBR-based master mix was used for qPCR: 20 µL reactions were made with ThermoPol buffer (New England Biolabs), and contained 2.5 mM MgSO4 ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative PCR was performed by transferring 2 μl of the RT mix to the qPCR mix prepared with Luna Universal qPCR Master Mix (M3003, New England Biolabs, MA, USA), according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2020Quote: ... in a 10 μL reaction mix containing 1X Luna Universal qPCR Master Mix (NEB) and 400 nM forward and reverse primers ...
-
bioRxiv - Microbiology 2020Quote: ... qPCR was performed using LUNA SYBR green qPCR reagents (New England Biolabs, Ipswich, MA, USA) using primers in the table ...
-
bioRxiv - Immunology 2024Quote: ... Two microliters were subsequently used in real-time quantitative PCR reactions containing SYBR-green based Luna universal dye qPCR mix (New England Biolabs) and gene specific PCR primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR experiments were performed using SsoAdvanced Universal SYBR Green Supermix (NEB) on the Quantstudio5 (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... qPCR was performed using LUNA SYBR green reagent (New England Biolabs) on a Qiagen Rotorgene instrument ...
-
bioRxiv - Genetics 2021Quote: ... RT-qPCR analysis was performed in Luna Universal qPCR Master Mix (New England Biolabs, #M3003) using a Roche LightCycler480 (Roche) ...
-
bioRxiv - Genomics 2020Quote: ... After cDNA synthesis qPCR reactions were performed using Luna Universal Probe qPCR Master Mix (NEB), custom primers and probes (IDT ...
-
bioRxiv - Genetics 2019Quote: ... qPCR was carried out with Luna Universal qPCR Master Mix (New England Biolabs, Ipswich, MA) using StepOnePlus (Thermo Fisher Scientific).
-
bioRxiv - Plant Biology 2022Quote: ... qPCR was used to quantify relative transcript levels using Luna qPCR Master Mix (NEB, USA) in the LightCycler 480 instrument (Roche ...
-
bioRxiv - Microbiology 2023Quote: ASV-specific qPCRs were performed with Luna Universal Probe qPCR Master Mix (New England Biolabs, Inc. ...
-
bioRxiv - Neuroscience 2022Quote: ... qPCR reactions were performed using Luna® Universal qPCR Master Mix (New England Biolabs #M3003).
-
bioRxiv - Microbiology 2023Quote: ... Dye-based qPCR was performed with Luna Universal qPCR Master Mix (#M3003, New England Biolabs) as recommended by the manufacturer ...
-
bioRxiv - Plant Biology 2023Quote: ... Real-time qPCR was performed using the Luna Universal Qpcr Master Mix (New England Biolabs), according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... qPCR was performed using the Luna Universal qPCR Master Mix (New England Biolabs, Ipswich MA) and the ThermoFisher StepOnePlus Real-Time PCR system to quantify the expression of GTL1 and the leaf proliferation stage marker ANGUSTIFOLIA 3 (AN3) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RT-qPCR was performed using the Luna Universal qPCR Master Mix (New England Biolabs). The comparative 2-ΔΔCT method was used to determine relative expression of the G9a cKO samples to compared the expression level of controls ...
-
bioRxiv - Genetics 2021Quote: ... RT-PCR was conducted using the Q5 High-Fidelity 2X Master Mix (NEB). All primers used in the current study are available in Table S1.
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were prepared using NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541) with the following conditions ...
-
bioRxiv - Molecular Biology 2020Quote: ... except that 5 uL of Phusion Hot Start Flex 2X Master Mix (NEB) was used ...
-
Pancreatic progenitor epigenome maps prioritize type 2 diabetes risk genes with roles in developmentbioRxiv - Genomics 2020Quote: ... Libraries were amplified using NEBNext High-Fidelity 2X PCR Master Mix (M0541, NEB) with primer extension at 72°C for 5 minutes ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were amplified using NEBNext High-Fidelity 2X PCR Master Mix (M0541, NEB) with primer extension at 72°C for 5 minutes ...
-
bioRxiv - Genetics 2021Quote: ... and 25 uL of NEBNext Q5U 2X Master mix (New England Biolabs M0597S), and 0.5uL 100X SYBR Green I (Thermo Scientific S7563 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The first amplification was conducted using OneTaq 2X Master Mix (NEB, Ipswich MA), a total of 6 μg genomic DNA and a limited amount of primers in 6 × 50 μL reactions with the following composition ...
-
bioRxiv - Bioengineering 2020Quote: ... with 12.5μL LongAmp Taq 2X Master Mix (New England Biolabs, Inc., Ipswich, MA), 9.5μL of H2O ...
-
bioRxiv - Neuroscience 2020Quote: ... Libraries were prepared with NEBNext High-Fidelity 2X PCR Master Mix (NEB M0541L), following standard protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR was performed using 2x LongAmp Taq Master Mix (New England Biolabs, M0287S) to select full- length transcripts followed by a second purification step using Agencourt beads (as described above) ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified for 13 cycles using Q5 High-Fidelity 2X Master Mix (NEB) according to manufacturer's instructions ...
-
bioRxiv - Genetics 2021Quote: ... 10 μl of Q5 Hot Start High-Fidelity 2x Master Mix (NEB M0494S), 1 μl of 10 μM shRNA_GA_F primer (5’ GAGAACTCTGAATAGATCTGTTCTAGAAAACATCCCATAAAACATCCCATATTCA-3’) ...