Labshake search
Citations for New England Biolabs :
501 - 550 of 4746 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... A 25μl PCR mix was prepared using 12.5μl OneTaq® Quick-Load® 2X Master Mix (New England Biolabs) with Standard Buffer ...
-
bioRxiv - Immunology 2020Quote: ... and qPCR was performed using SYBR Green (Dynamo HS kit; New England Biolabs) kit in a QuantStudio™ 3 Reak-Time PCR Instrument (Applied Biosystems) ...
-
bioRxiv - Genomics 2020Quote: ... were dispensed at 35nL in wells that contained single cells followed by two dispenses of 50nL (100nL total) 2x NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541L). The chip was sealed and spun down at 2250xg for 3 mins after each dispense ...
-
bioRxiv - Immunology 2022Quote: ... RT-qPCR analysis was performed using New England Biotech LUNA SYBR Green qPCR reagents (New England Biolabs, U.K.). Glyceraldehyde phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Systems Biology 2020Quote: ... were used along with Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs) to perform two-step polymerase-chain reaction (PCR) ...
-
bioRxiv - Genetics 2019Quote: PCRs were performed with the Q5 Hot-start 2x master mix (New England Biolabs (NEB)) and cloning was performed using the In-Fusion HD cloning kit (Takara Bio ...
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were generated by PCR amplification using NEBNext High-Fidelity 2X PCR Master Mix (NEB). The resulting libraries were multiplexed and sequenced in a HiSeq 4000 pair-end lane producing 100M of 49-bp pair end reads per sample.
-
bioRxiv - Developmental Biology 2020Quote: ... PCR products were produced with the Q5 High-Fidelity 2X Master Mix (New England Biolabs). All inserts were verified by sequencing ...
-
bioRxiv - Genomics 2019Quote: ... and the NEBNext High Fidelity 2X PCR Master Mix (New England Biolabs; Ipswich, MA, USA). PCR reactions were cleaned up with one volume AmpureXP beads ...
-
bioRxiv - Genetics 2019Quote: ... but using NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs, Ipswich, U.S.). Finally ...
-
bioRxiv - Genetics 2020Quote: ... PCR amplification was performed using Phusion 2X Master Mix HotStart Flex (New England Biolabs M0536L), 10µM primer pair (see Key Resources Table Oligonucleotides) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Cycling protocols were based on manufacturer recommendations for OneTaq Hot Start 2X Master Mix (NEB) and/or Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB ...
-
bioRxiv - Neuroscience 2020Quote: The introns were PCR amplified using Q5 Hot Start 2x Master Mix (New England BioLabs) with primers designed to contain homology arms to their respective targets ...
-
bioRxiv - Microbiology 2021Quote: ... and PCR carried out using Q5® High-Fidelity 2X Master Mix (New England Biolabs) as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... The template was PCR amplified (Taq 2x master mix, NEB M0270; Bridge primers; 15 cycles) and size selected by 2% agar gel.
-
bioRxiv - Cancer Biology 2020Quote: ... and 25 μl of NEBNext High Fidelity PCR Master 2X Mix (New Englarnd Biolabs, M0541L). The primer sequences and their description ...
-
bioRxiv - Molecular Biology 2021Quote: WarmStart® Colorimetric LAMP 2X Master Mix (DNA & RNA) was purchased from NEB (MA, USA). The iNAAT reaction volume was 15 μl ...
-
bioRxiv - Molecular Biology 2020Quote: WarmStart® Colorimetric LAMP 2X Master Mix (DNA & RNA) was purchased from NEB (MA, USA). The LAMP assay reaction volume was 15 μl ...
-
bioRxiv - Immunology 2020Quote: ... Each PCR reaction was performed using Q5 Hot Start High Fidelity 2X Master Mix (NEB). For the first round of PCR ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR products were produced with the Q5 High-Fidelity 2X Master Mix (New England Biolabs). All inserts were verified by sequencing.
-
bioRxiv - Neuroscience 2020Quote: ... 25 μl of the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs, M0541S), and 5 µL of the Illumina PCR Primer Cocktail (PPC ...
-
bioRxiv - Genomics 2022Quote: ... Each PCR#2 reaction contained 25 µL of Q5 High-Fidelity 2X Master Mix (NEB), 2.5 µL of a unique Nuc PCR#2 Fwd Primer (10 µM) ...
-
bioRxiv - Genomics 2022Quote: ... Each “PCR#1” reaction contained 25 µL of Q5 High-Fidelity 2X Master Mix (NEB), 2.5 µL of Nuc PCR#1 Fwd Primer (10 µM) ...
-
bioRxiv - Cancer Biology 2022Quote: ... second-strand synthesis was performed using the 2x LongAmp Taq Master Mix (New England Biolabs). The resulting double-stranded cDNA was subjected to end-repair and dA-tailing using the NEBNext Ultra End Repair/dA-Tailing Module (New England Biolabs) ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR products were produced with the Q5 High-Fidelity 2x Master Mix (New England Biolabs). Some fragments were ordered as gBlocks at IDT ...
-
bioRxiv - Molecular Biology 2019Quote: ... 12.5 µl of Q5 High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA, USA), 1.25 µl each of 10 µM forward and reverse primers ...
-
bioRxiv - Developmental Biology 2019Quote: ... and PCR was amplified with high-fidelity 2X PCR Master Mix (New England Biolabs M0541). One-third of the maximum fluorescent intensity was used to determine the additional cycles ...
-
bioRxiv - Microbiology 2019Quote: ... libraries were amplified with NEBNext High-Fidelty 2x PCR Master Mix (NEB, cat. number: M0541), the RP1 common primer and a uniquely selected index primer ...
-
bioRxiv - Microbiology 2021Quote: ... 25□µL NEBNext High-Fidelity 2X PCR master mix (New England Biolabs Inc., Ipswich, MA), 5□µL of each index primer ...
-
bioRxiv - Developmental Biology 2019Quote: ... as template utilizing Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, #M0494L). The PCR fragments were gel-purified using the QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Genomics 2020Quote: ... Pools were amplified using Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs), PCR cycling conditions ...
-
bioRxiv - Genomics 2021Quote: ... then 20 µl of 2X PCR master mix (New England Biolabs, New England Biolabs, M0541S) was added to the samples ...
-
bioRxiv - Genomics 2021Quote: ... then 20 µl of 2X PCR master mix (New England Biolabs, New England Biolabs, M0541S) was added to the samples ...
-
bioRxiv - Cancer Biology 2021Quote: ... sgRNA inserts were amplified with NEBNext High-Fidelity 2X PCR Master Mix (New England BioLabs). Samples were then pooled in equimolar concentrations ...
-
bioRxiv - Developmental Biology 2020Quote: ... or Taq 2x Master Mix Kit (New England Biolabs® Inc., Ipswich, MA, USA; #M0270L) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: PCRs were performed with the Q5 Hot-start 2x master mix (New England Biolabs (NEB)) and cloning was performed using the In-Fusion HD cloning kit (Takara Bio ...
-
bioRxiv - Genomics 2020Quote: ... Using primers 642F and 643R and NEBNext High-Fidelity 2X PCR Master Mix (NEB M0541L), PCR was run for 10 cycles with the following parameters ...
-
bioRxiv - Genetics 2019Quote: ... gRNA cassettes were amplified separately using Q5 Hot Start High-Fidelity 2X Master Mix (NEB) and primers #1 and #463 for 5’ or #605 and #430 for 3’ cassette ...
-
bioRxiv - Genetics 2019Quote: ... PCR products were produced with the Q5 High-Fidelity 2X Master Mix (New England Biolabs). All inserts were verified by sequencing ...
-
bioRxiv - Bioengineering 2022Quote: ... PCR was performed with Q5® High-Fidelity 2X Master Mix (New England Biolabs (NEB) #M0492 ...
-
bioRxiv - Bioengineering 2022Quote: ... PCR was performed with Q5® High-Fidelity 2X Master Mix (New England Biolabs (NEB) #M0492 ...
-
bioRxiv - Microbiology 2022Quote: ... with Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, Ipswich, MA, USA) and annealing conditions of 54°C for 25 cycles ...
-
bioRxiv - Zoology 2023Quote: ... Polymerase chain reaction (PCR) was performed using LongAmp Taq 2X Master Mix (New England Biolabs) and previously described primers GLU (5’ GACTTGAAGAACCACCGTTG 3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... Illumina Nextera XT SetA indexes and NEBNext High-Fidelity 2X PCR Master mix (NEB, M0541) are used to amplify the fragmented products of each sample ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplicons encompassing exon 2 of SERINC3 were produced using Taq 2x Master Mix (NEB) and the following primers ...
-
bioRxiv - Microbiology 2022Quote: ... [19,21] Each PCR included 12.5 µL Q5 High Fidelity 2x Master Mix (New England Biolabs), 1.1 µL of either pool 1 or pool 2 10 µM primer master mix ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The PCRs were performed with Q5® High-Fidelity 2X Master Mix (New England Biolabs) with the designed synthetic primers (SigmaAldrich) ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR was amplified with high-fidelity 2x PCR Master Mix (New England Biolabs M0541). One-third of the maximum fluorescent intensity during a qPCR trial run was used to determine the additional cycles for library prep ...
-
bioRxiv - Bioengineering 2022Quote: Genomic PCR was performed using NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs) with the primers listed in Supplementary Table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reaction mixture contained: 12.5 µL LUNA LongAmp Taq 2x Master Mix (NEB M0287S), 5.5 µL Nuclease-Free Water (ThermoFisher Scientific #AM9937) ...