Labshake search
Citations for New England Biolabs :
551 - 600 of 4746 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The PCR reaction mixture contained: 12.5 µL LUNA LongAmp Taq 2x Master Mix (NEB M0287S), 5.5 µL Nuclease-Free Water (ThermoFisher Scientific #AM9937) ...
-
bioRxiv - Genetics 2023Quote: ... 200ng of RNA-equivalent cDNA was amplified with LongAmp Taq 2X Master Mix (NEB #M0287S) and gene-specific primers tailed with Oxford Nanopore universal sequences (Supplementary Table S3) ...
-
bioRxiv - Immunology 2023Quote: ... 12.5 µl of OneTaq Quick-Load 2X Master Mix with Standard Buffer (New England Biolabs), 2 µl of diluted (1:10 ...
-
bioRxiv - Molecular Biology 2023Quote: ... ATAC-seq libraries were prepared using NEBNext High-Fidelity 2X PCR Master Mix (NEB, #M0541), a uniquely barcoded primer per sample ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR was performed with 2x NEBNext High-Fidelity PCR Master Mix (New England Biolabs, M0541S) and 10 μM primers (Table S2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by PCR amplification using NEBNext High-Fidelity 2X PCR Master Mix (NEB). The resulting libraries were multiplexed and sequenced in a HiSeq 4000 paired-end lane ...
-
bioRxiv - Microbiology 2023Quote: ... PCR reactions were performed with 2x OneTaq HotStart DNA Polymerase master mix (New England Biolabs), using 6 μl of forward and reverse primer (1μM each) ...
-
bioRxiv - Genomics 2023Quote: ... The outward PCR experiments were performed using NEBNext High-Fidelity 2X PCR Master Mix (NEB). For a 50 µl reaction ...
-
bioRxiv - Genomics 2023Quote: ... pooled oligonucleotides were amplified via PCR using NEBNext 2X Hi-Fi PCR Master Mix (NEB) and primers:
-
bioRxiv - Microbiology 2023Quote: ... 2 μL of each ATAC-seq library was added to 2x NEBNext Master Mix (NEB) and 0.4x SYBR Green (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were generated by PCR amplification using NEBNext High-Fidelity 2X PCR Master Mix (NEB). The resulting libraries were purified using MinElute PCR Purification Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... and PCR carried out using Q5® High-Fidelity 2X Master Mix (New England Biolabs) as per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Amplification was done using the Q5 High-Fidelity 2X Master Mix (NEB, catalog no. M0492S) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All in vitro PCR reactions were performed using Q5 High-Fidelity 2X Master Mix (NEB). Yeast colony PCR reactions were done as previously reported20 using DreamTaq DNA polymerase (ThermoFisher) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR assembly was performed using the Q5 High-Fidelity 2X Master Mix (New England Biolabs), 4 µM of 5′ terminal primer ...
-
bioRxiv - Genomics 2023Quote: ... and PCR amplification with Q5® High-Fidelity 2X Master Mix (NEB, catalog no. M0492S). PCR products were confirmed by Sanger sequencing (Genewiz)
-
bioRxiv - Genomics 2023Quote: ... Pre-amplification was performed by addition of 30 μL 2x Q5U Master Mix (NEB M0597S), 0.4 μL 100 μM pre-amplification forward primer and 0.4 μL 100 μM pre-amplification reverse primer (SI Appendix ...
-
bioRxiv - Biophysics 2023Quote: ... and Q5 Hot Start High-Fidelity 2X PCR Master Mix (New England Biolabs, Ipswich, MA). The transcribed region had the following spacings ...
-
bioRxiv - Immunology 2024Quote: ... The reaction consisted of 50 µL of NEBNext High Fidelity 2X PCR Master Mix (NEB), 4 µg of genomic DNA ...
-
bioRxiv - Microbiology 2024Quote: ... All PCR reactions were performed using Q5 High-Fidelity 2X Master Mix (NEB, Frankfurt, Germany). The PCR product was purified and sequencing was done using a gene specific primer (GSP3) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µl of LongAmp Taq 2x master mix (New England Biolabs, Ipswich, Massachusetts, United States), and 2.5 µl of the PCR product as template ...
-
bioRxiv - Bioengineering 2024Quote: ... amplified with Q5® Hot Start 2x Master Mix (New England Biolabs, Ipswich, Massachusetts, US). Target DNA was purified with a PureLink® PCR cleanup kit (Invitrogen) ...
-
bioRxiv - Bioengineering 2024Quote: ... PCRs were carried out using the Q5 Hot Start 2x Master Mix (NEB, Ipswich, MA) according to the manufacturer’s protocol for 30 cycles ...
-
bioRxiv - Cell Biology 2024Quote: ... The editing region was amplified with PCR using Q5 High-Fidelity 2X Master Mix (NEB) followed by purification the PCR product using the QIAquick PCR Purification Kit (QIAGEN) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Twist Bioscience) followed by PCR amplification using NEBNext HiFidelity 2X Master Mix (New England BioLabs) with Fwd Primer (GTAACTTGAAAGTATTTCGATTTCTTG- GCTTTATATATCTTGTGGAAAGGACGAAACACC ...
-
bioRxiv - Microbiology 2020Quote: ... The qPCR was conducted with the Agilent Mx3005P qPCR System and the Luna® Universal qPCR Master Mix (New England Biolabs). The temperature profile used throughout was the recommended standard for the master mix.
-
bioRxiv - Genomics 2019Quote: ... and NEB Luna Universal Probe qPCR Master Mix (New England Biolabs, Ipswich, MA). We measured expression in triplicate in three independent experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... PTEN and TP53 by using Luna® Universal qPCR Master Mix (NEB - M0003) as SybrGreen Probe on an Ariamx Real-Time PCR System (Agilent) ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative RT-PCR using Luna® Universal qPCR Master Mix (New England BioLabs) was performed with the following cycling conditions on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The qRT-PCR assay was performed using Luna Universal qPCR Master Mix (NEB) with a total volume of 20 µl ...
-
bioRxiv - Immunology 2021Quote: ... using Luna® Universal Probe qPCR Master Mix (New England BioLabs® Inc). The large ribosomal protein P0 (RPLP0 ...
-
bioRxiv - Microbiology 2019Quote: ... using Luna Universal Probe qPCR Master Mix (New England Biolabs, Ipswich, MA, USA). Primers and probes were used to target the β-actin gene for human DNA detection16 and the porA pseudogene for detection of N ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 6.5 µl of Luna® Universal qPCR Master Mix (New England BioLabs). PCR conditions were ...
-
bioRxiv - Microbiology 2022Quote: ... We used 2× Luna® Universal qPCR Master Mix (New England Biolabs [NEB]) for quantitative PCR in a volume of 20 µL and primer concentrations of 250 nM each for the forward and reverse primers ...
-
bioRxiv - Microbiology 2022Quote: ... We used 2× Luna® Universal qPCR Master Mix (New England Biolabs [NEB]) for quantitative PCR in a volume of 20 µL and primer concentrations of 250 nM each for the forward and reverse primers ...
-
bioRxiv - Microbiology 2022Quote: ... we used the Luna® Universal qPCR Master mix from NEB (Ref M3003E) with primers described in Table 3 at 250 nM each to target specifically each phage genome or OPM 80-81 primers to target the yersiniabactin biosynthesis salycil-AMP ligase protein encoding gene (ybtE ...
-
bioRxiv - Molecular Biology 2022Quote: ... Quantitative PCR was performed in duplicate with Luna Universal qPCR Master Mix (NEB) using QuantStudio 5 Real-Time PCR System (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative PCR was performed with Luna® Universal qPCR Master Mix (NEB #M3003) and Biorad CFX96 Real time PCR system ...
-
bioRxiv - Developmental Biology 2024Quote: ... using the Luna® Universal qPCR Master Mix Protocol (M3003E, New England Biolabs) in 96-well Biorad qPCR plates and a CFX384 Touch Real-Time PCR Detection System (Biorad ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µl of Luna® Universal qPCR Master Mix (Biolabs, Ipswich, MA, USA) and 2 μl from 1:20 diluted cDNA template.
-
bioRxiv - Immunology 2019Quote: ... Real-time qPCR was performed using the Luna Universal Probe qPCR Master Mix (New England Biolabs, Ipswich, MA) with amplification on the Biorad CFX96 Real Time PCR Detection system ...
-
bioRxiv - Synthetic Biology 2021Quote: ... qPCR was carried out using the primers in Supplementary Table 3 and Luna Universal qPCR Master Mix (NEB) in a BioRad iCycler in technical triplicates for each biological replicate ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was carried out on a Bio-Rad CFX96 using Luna Universal qPCR Master Mix (New England BioLabs). Primers used for qPCR were previously validated from other studies and are indicated in Supplementary Table 3.
-
bioRxiv - Plant Biology 2023Quote: ... The synthesized cDNA was analyzed using qPCR using Luna® Universal qPCR Master Mix (NEB, catalog number M3003). qPCR data was analyzed as previously described57.
-
bioRxiv - Bioengineering 2023Quote: All qPCR reactions were set up using 7.5 µl of 2 x Luna Universal qPCR master mix (NEB), 0.375 pmol forward primer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... long-range PCR was performed to amplify the complete gene with the same mix composition as above except that the LongAmp HotStart Taq 2X Master Mix (New England Biolabs) was used instead ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 μl cDNA reaction mix was amplified by adding 25 μl of Long Amp Taq 2x Master Mix (NEB-kit), 1.25 μl SR primer for Illumina (NEB-kit) ...
-
bioRxiv - Immunology 2022Quote: ... cells were brought to 5×105 cells/ml and incubated with transposition reaction mix (NEBNext High-Fidelity 2X PCR master mix, NEB) for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR reaction was performed using 1 μl of undiluted cDNA template synthesized from 1 µg of total RNA extracted from a mix of male and female individuals using Q5 Hot Start High-Fidelity 2X Master Mix (NEB), as described above ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was amplified using Q5® High-Fidelity 2X Master Mix (New England BioLabs® M0492L) from 100ng of genomic DNA according to the protocol provided by the manufacturer ...