Labshake search
Citations for New England Biolabs :
3051 - 3100 of 6440 citations for Type 1 Angiotensin II Receptor AGTR1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... Fragmented gDNA was ligated to NEBNext Adaptor for Illumina using NEBNext Ultra II DNA library prep kit for Illumina (New England Biolabs, cat. No. E7645). We performed bisulfite conversion twice with ligated libraries (QIAGEN ...
-
bioRxiv - Genetics 2020Quote: ... Reverse transcription reactions were then used as input for the NEBNext® Ultra II Non-Directional RNA Second Strand Synthesis Module (New England Biolabs, cat. E6111L). Second strand synthesis was performed by incubating 1 h at 16°C ...
-
bioRxiv - Genomics 2021Quote: ... 500 ng of genomic DNA was directly processed for DNA end repair with NEBNext Ultra II End repair/dA-tailing Module (New England Biolabs, catalog no. E7546). Barcodes were ligated to the end-repaired DNA and purified with 0.1× or 0.15× beads (Omega Bio-Tek Inc ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were prepared by the Cornell Transcriptional Regulation and Expression (TREx) Facility using the NEBNext Ultra II Directional RNA kit (New England Biolabs, E7760, Ipswich, MA). Sequencing was performed at the Biotechnology Research Center at Cornell University on the NextSeq500 (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were prepared by the Cornell Transcriptional Regulation and Expression (TREx) Facility using the NEBNext Ultra II Directional RNA kit (New England Biolabs, E7760, Ipswich, MA). Sequencing was performed at the Biotechnology Research Center at Cornell University on the NextSeq500 (Illumina ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... samples were diluted in 10 μl of RNase-free water and 5 μl of the sample were used for RNA library construction using NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... All libraries were prepared using NEBNext Poly(A) mRNA magnetic isolation modules and Ultra II Directional Library Prep kits (New England BioLabs, Inc, MA, USA) according to standard protocol ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA strand synthesis and indexing were carried out using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs) according to the supplier’s manual ...
-
bioRxiv - Molecular Biology 2021Quote: ... Libraries were prepared from ∼500ng of input or IP DNA using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB) according to kit instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 30 ng of the sheared DNA were used for end-prep reaction using theNEBNext® Ultra™ II End Repair/dA-Tailing (E7546, New England Biolabs, USA). A double strand DNA fragment was formed by heating two oligonucleotides (NP_adapt_2_fw 5’ AAAGACAACCACGACTATAACGT 3’ and NP_adapt_2_rv 5’ CGTTATAGTCGTGGTTGTCTTT 3’ ...
-
bioRxiv - Genomics 2021Quote: ... The purified product was quantified using Qubit dsDNA HS assay kit and 50ng of the product was further taken for adaptor ligation using adapter mix II and quick T4 DNA ligase (Cat. No. E6056S, New England Biolabs, Ipswich, Massachusetts, USA) followed by 20 mins incubation at room temperature ...
-
bioRxiv - Genomics 2021Quote: ... cDNA libraries were generated with NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs, Ipswich, Massachusetts) and subsequently sequenced in paired-end mode with 150- bp read length on a NextSeq500 to obtain ∼40 mio reads (Illumina ...
-
bioRxiv - Genetics 2020Quote: ... and RNA sequencing was performed using NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs, E7760S) according to manufacturer’s recommendations ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was fragmented and TruSeq-Adapters ligated with the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina® (NEB) and 3′-end-fragments were finally amplified using primers with Illumina P5 and P7 overhangs ...
-
bioRxiv - Molecular Biology 2022Quote: ... 25 μl of which were transferred to a new tube and subjected to a NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (NEB #E7645), using half of the recommended reagents’ volumes ...
-
bioRxiv - Molecular Biology 2022Quote: ... AGTCCCCAGCACATAGAAGG hWISP1_negative_reverse: GGTTCTGAAGGTGACCGACT ChIP-seq libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB E7645) according to manufacturer instructions with a few modifications ...
-
bioRxiv - Molecular Biology 2022Quote: ... The purified IP products were taken for library preparation using NEBNext® Ultra™ II DNA Library Prep with Sample Purification Beads (NEB, E7103L) as per manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Two DNA sequencing libraries were prepared from two wAlbB S mosquitoes using the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina (New England Biolabs, E7805L) and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs ...
-
bioRxiv - Genomics 2022Quote: The linear vector used in the ATAC-STARR-seq gibson cloning step was generated by a single 50μL PCR reaction using NEBNext® Ultra™ II Q5® Master Mix (NEB, #M0544S). While not necessary for this study ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were prepared from 100 ng of DNA using the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina (NEB E7805L) with NEBNext® Multiplex Oligos for Illumina® (E7600S) ...
-
bioRxiv - Microbiology 2022Quote: Meta3C sequencing libraries were generated with the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina (NEB catalogue number #E6177) following the manufacturer’s protocol with barcoding of the MluCI and HpaII libraries with the NEBNext® Multiplex Oligos for Illuminia® (NEB #E7335) ...
-
bioRxiv - Plant Biology 2022Quote: ... A total of 0.5 μg of total RNA per biological replicate were used for preparing 150 bp paired-end (PE) read libraries using the NEBNext®Ultra™ II RNA Library Prep Kit (New England Biolabs, Inc.). Small RNA was extracted using a Plant miRNA kit (Omega Bio-tek Inc.) ...
-
bioRxiv - Molecular Biology 2023Quote: ... All the fragments were cloned into the pBluescript II SK (+) plasmid using the NEBuilder HiFi DNA Assembly (New England Biolabs, Ipswich, MA, USA). Constructs were amplified by PCR prior to their transformation in U ...
-
bioRxiv - Microbiology 2023Quote: ... and metagenomic libraries were prepared using 50 ng of DNA and the NEBNext Ultra II DNA Library Prep Kit (New England BioLabs, Ipswich, MA, USA) as per the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: ... ligated to sequencing adapters and amplified using NEBNext® UltraTM II DNA Library Prep Kit for Illumina® and NEBNext Multiplex Oligos for Illumina® (New England Biolabs). The amplified DNA (around 275 bp in size ...
-
bioRxiv - Molecular Biology 2022Quote: ... Library preparation was performed with the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs E7760S) and paired end sequencing was performed on the Nextseq 550 platform (Illumina) ...
-
bioRxiv - Plant Biology 2022Quote: ... One microgram of total RNA was used to prepare each sequencing library with the NEBNext Ultra II Directional RNA library prep kit (New England Biolabs Japan, Tokyo, Japan) following the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2024Quote: ... The poly(A) mRNA-enriched libraries were constructed using NEBNext® Ultra™ II RNA Library Prep Kit (New England BioLabs, Ipswich, MA). Paired-end sequencing (2×150 bp ...
-
bioRxiv - Zoology 2023Quote: Reverse transcription was conducted with 10 µL of eluted nucleic acids using the ProtoScript® II Reverse Transcriptase (New England Biolabs, Massachusetts, USA). For each sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... Strand-specific RNA-seq libraries were prepared with the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® sequencing (E7760S) according to the manufacturer’s protocol (New England Biolabs, MA USA). Briefly ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA libraries were generated from 500 ng of total RNA using NEBNext Ultra II Directional Poly-A RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA; #E7760). cDNA library quality and quantity were assessed by TapeStation 2200 and Qubit (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ChIP-seq and MNase-seq libraries were made using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, cat. no. E7645S) and Agencourt Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2023Quote: ... followed by the second DNA chain synthesis using NEBNext Ultra II Non-Directional RNA Second Strand Synthesis Module (New England Biolabs, Ipswich, MA, USA). The obtained cDNA was used to prepare a NEBNext DNA Library Prep Set for Ion Torrent (New England Biolabs ...
-
bioRxiv - Genomics 2024Quote: ... An Illumina sequencing library was produced for each leaf using an optimised NEBNext Ultra II DNA library protocol (New England Biolabs, Ipswich, MA, USA). Libraries were pooled into multiplexes after independently labelling each library prior to whole genome sequencing (WGS ...
-
bioRxiv - Immunology 2024Quote: ... were prepared and sequenced at Azenta (South Plainfield, NJ) using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA). The sequencing libraries were validated on the Agilent TapeStation ...
-
bioRxiv - Genetics 2024Quote: ... The fragmented samples were purified with Expin™ PCR SV kit (GeneAll) and prepared as an NGS library with NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB). The prepared samples were sequenced with MiniSeq High Output Reagent Kit (300-cycles ...
-
bioRxiv - Cancer Biology 2023Quote: Polyadenylated RNA enrichment and library preparation were conducted using the NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext Ultra II Directional RNA Library Prep Kit (NEB, #E7490S and #E7760S), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA-seq libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA). Libraries were sequenced on an Illumina NovaSeq 6000 sequencer.
-
bioRxiv - Microbiology 2022Quote: ... 16S libraries were prepared using NEBNext® Ultra™ II DNA Library Prep Modules for Illumina® (catalogue number E7645L; New English Biolabs, Ipswich ...
-
bioRxiv - Genomics 2023Quote: ... were used to remove rRNA from total RNA and libraries prepared using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB, New England Biolabs). The libraries were sequenced on an Illumina NovaSeq S4 (Illumina ...
-
bioRxiv - Plant Biology 2023Quote: Libraries for each sample were prepared using the NEBNext Ultra II DNA Library Prep Kit and NEBNext Muliplex Oligos for Illumina Kits (New England Biolabs, Ipswich, Massachusetts, USA) following the NEBNext Ultra II Version 5 protocol with size selection on DNA fragments at 300-400bp range ...
-
VapC12 ribonuclease toxin modulates host immune response during Mycobacterium tuberculosis infectionbioRxiv - Microbiology 2023Quote: ... NEB Ultra II directional RNA-sequencing Library Prep kit protocol was used to prepare libraries for total RNA-Seq (NEB, catalog no. E7760L). An initial concentration of 500ng of total RNA was taken for the assay ...
-
bioRxiv - Plant Biology 2023Quote: ... Sheared DNA was then used to generate barcoded libraries utilizing NEBNext Ultra II DNA Library Prep Kit (New England Biolabs, Ipswich, Massachusetts, USA). Libraries produced followed the NEBNext Ultra II Version 5 protocol with size selection on DNA fragments at 300-400bp range but were adjusted by halving the amount of reagents and DNA used to save on supplies and resources ...
-
bioRxiv - Cell Biology 2023Quote: ... Sequencing libraries were prepared using “NEBNext Ultra II Directional RNA Library Prep Kit for Illumina” combined with “NEB Ultra II polyA mRNA magnetic isolation” for mRNA enrichment (New England Biolabs, Ipswich, MA, USA). Libraries were pooled and sequenced (single-end ...
-
bioRxiv - Molecular Biology 2023Quote: ... the DNA pellet was resuspended in 0.1 X TE and used for DNA library generation with the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (New England Biolabs). Adaptor ligation was performed with 1:25 diluted adaptor and 15 cycles were used for library amplification using dual indices (NEB dual index kit) ...
-
bioRxiv - Immunology 2023Quote: ... dual unique indexed libraries for sequencing on Illumina platforms were generated using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs). The manufacturer’s protocol was modified by diluting adapters 1:30 and using 3 µL of this dilution ...
-
bioRxiv - Genomics 2023Quote: ... polyA-enriched fraction was used for library construction using the NEBnext Ultra II Directional Library Prep Kit for Illumina (New England Biolabs, Cat. No. E7760L), following the standard protocol but using half the reaction volumes recommended ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA; E11.5 samples) and the TruSeq stranded mRNA Library prep (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... and one short read library using the NEBNext Ultra II FS DNA Library Kit for Illumina (New England BioLabs Inc., Ipswich, MA, USA). The long-read library was then sequenced on the PacBio Sequel IIe system in CLR mode using the Sequel II Binding Kit 2.2 (PacBio) ...
-
bioRxiv - Genetics 2023Quote: ... A strand-specific RNA sequencing library was prepared using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, Ipswich, MA, USA). Then ...