Labshake search
Citations for New England Biolabs :
2501 - 2550 of 7437 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2022Quote: ... We created a single library by pooling these products after dual barcoding using Nextera N5/N7 primers and OneTaq Polymerase (New England Biolabs). We then cleaned the library using Ampure XP (Beckman Coulter ...
-
bioRxiv - Biophysics 2022Quote: ... The final double strand DNA fragments pool was ligated with adapters and amplified with Illumina index primers by using NEBNext Ultra II NGS library prep kit (NEB). The prepared NGS library was sequenced as 150×150 bp pair-end sequencing in the Miseq or Hiseq 2500.
-
bioRxiv - Evolutionary Biology 2022Quote: ... The splicing isoforms were then amplified with minigene-specific primers (F: CTGGCTAACTAGAGAACCCACTGC; R: GGCAACTAGAAGGCACAGTCG) and 32P-labeled dCTP using Q5 High-Fidelity DNA Polymerase (New England Biolabs) following the manufacturer′s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5μg genomic DNA of each tumor was used as template in a pre-amplification reaction using unique barcoded primer combination for each tumor with 20 cycles and Q5 High-Fidelity DNA Polymerase (NEB). The following primers were used:
-
bioRxiv - Cancer Biology 2022Quote: ... 5ul of PCR1 product as template was amplified using unique i5 and i7 index primer combinations with 8 cycles and Q5 High-Fidelity DNA Polymerase (NEB) for each individual sample to allow pooling of sequencing libraries ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was then subjected to a primer extension reaction with dUTP to separate the nascent strand from its complement (1X NEB buffer2 ...
-
bioRxiv - Molecular Biology 2020Quote: Gene-specific primers (Supplementary Table 4) were labeled with [γ-32P]ATP by phage T4 polynucleotide kinase (New England Biolabs), as recommended by the manufacturer ...
-
bioRxiv - Molecular Biology 2019Quote: ... The AGO1 ORF along with its upstream and downstream sequence was amplified (primers: AGO1-Intergenic-For 5′-GCTGGAGCTCTGAACGTGTGGAAGACCAAA; AGO1-Intergenic-Rev 5′-ATGACTCGAGAGTGGCTAACGGCAACATATC) and inserted between the SacI and XhoI (NEB) restriction sites of pRS404 ...
-
bioRxiv - Plant Biology 2021Quote: ... Flanking sequences 5’ and 3’ of the coding regions were amplified with appropriate primer pairs (Table S2) using Phusion DNA polymerase (New England Biolabs) and cloned into pDONR 221 P1-P4 and pDONR 221 P3-P2 ...
-
bioRxiv - Microbiology 2020Quote: ... The efgA coding sequence plus 30 bp at the 5’ end was amplified using primers with 30 nt overlaps to permit Gibson assembly (HiFi DNA Assembly, New England Biolabs) into pAH120 [40] that had been digested with XbaI and NdeI ...
-
bioRxiv - Cell Biology 2020Quote: ... double-strand DNA repair templates were amplified with PCR from the plasmids pSL779 for gfp or pSL780 for mKate2 using Phusion polymerase and the primers listed in table 2 (New England Biolabs) (Bone ...
-
bioRxiv - Microbiology 2020Quote: ... The resulting gDNA was used as template for PCR amplification of the shRNA encoding regions using the Fw-NGS and the Rev-NGS primers (IDT Technologies) and the Phusion High Fidelity DNA polymerase (NEB). Three PCRs per condition were performed and the amplicons combined ...
-
bioRxiv - Neuroscience 2021Quote: ... libraries of sensors in the pRSET-A bacterial expression vector were generated using primers containing degenerate codons (NNS) with Q5 site-directed mutagenesis (New England BioLabs) and transformed into T7 Express competent cells (New England BioLabs) ...
-
bioRxiv - Microbiology 2020Quote: ... A 56-nt ssDNA oligonucleotide encoding a central tract of 20 degenerate nucleotides (oBFC1397) was amplified with BsmBI-encoding primers oBFC1398 and oBFC1399 using Q5 High-Fidelity 2X Master Mix (NEB) in a six-cycle PCR (98°C for 1 min ...
-
bioRxiv - Microbiology 2022Quote: ... The double-stranded DNA was then synthesized and amplified by PCR from the poly(AG)-tailed ssDNA using the primers BLV-F2 and NV-oligo-dT-ADP1 and Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs). The second PCR was performed using diluted PCR products ...
-
bioRxiv - Microbiology 2022Quote: ... and a 609bp sequence with the ydgA pseudogene (common binding site for reverse primer) were synthesized (gBlocks, Integrated DNA Technologies) and cloned by Gibson Assembly Master Mix (NEB) into an NBU2 plasmid carrying the erythromycin resistant cassette ermG (tagged B.theta-EryR strains) ...
-
bioRxiv - Biochemistry 2022Quote: Site-directed mutagenesis to generate alanine or tryptophan substitutions at H2 positions in NIP constructs was done by using the mutagenesis primers listed in Table SI and the Q5 Site-Directed Mutagenesis Kit (NEB) as described previously (50) ...
-
bioRxiv - Microbiology 2022Quote: ... Mutations were introduced into the phCMV-Spike plasmids using the mutagenic primers and the Q5 site directed mutagenesis kit (NEB). In addition ...
-
bioRxiv - Cell Biology 2022Quote: ... Sequences for entry modules were obtained via PCR-amplification of the target DNA sequence using primers that contain a ∼20bp overlap with the entry module using high-fidelity polymerase Q5 (NEB). For UM011_0103 ...
-
bioRxiv - Bioengineering 2019Quote: ... First-strand cDNA was synthesized using a random hexamer primer and M-MuLV reverse transcriptase (RNase H-; New England Biolabs). Second-strand cDNA synthesis was subsequently performed using DNA polymerase I and RNase H ...
-
bioRxiv - Biochemistry 2019Quote: ... were produced by PCR amplification of the starting plasmid with forward and reverse mutagenesis primers containing the desired mutations (Table S9) followed by DpnI (NEB) treatment ...
-
bioRxiv - Biophysics 2019Quote: ... Site directed mutagenesis of the HEV510-696 was performed using primers detailed in Table 1 and the Q5 Site-directed Mutagenesis Kit (NEB).
-
bioRxiv - Biochemistry 2019Quote: ... encoding the reverse complement of the Illumina Read1 primer binding site (R1R) using Thermostable 5’ AppDNA/RNA Ligase (New England Biolabs). Ligated cDNAs were re-purified with MinElute Reaction Cleanup Kit and amplified by PCR for 12 cycles using Phusion DNA polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... Mixed diluted primers (1.7 μl) were combined with 1 μl of annealing buffer (10X NEBuffer 4, New England Biolabs Inc.) on ice in reaction tubes ...
-
bioRxiv - Biophysics 2019Quote: ... All the p53[R273] point mutations are done using overlap extension polymerase chain reaction by primers which are shown in Table S2 and then digested with Nde1(NEB) & BamH1(NEB ...
-
bioRxiv - Neuroscience 2019Quote: ... encoding full length Ppp3cc was amplified with primers 5’- AGATTACGCTATCTGTACAGAATTCACCATGTCCGTGAGGCGC-3’ and 5’-GGCCGCTAGCCCGGGTACCGAATTCTTACAGGGCTTTCTTTCCATGGTC-3’ and inserted into pCAG-HA vector using NEB Builder (NEB).
-
bioRxiv - Molecular Biology 2019Quote: ... DNase-treated samples were dissolved in 10 μl water and used for sequencing library preparation using the NEBNext Directional Ultra RNA kit and Indexing primers (E7530, and E7335, respectively, both NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNase-treated samples were dissolved in 10 μl water and used for library preparation using the NEBNext Ultra II Directional RNA Library Prep Kit and Indexing primers (E7760, and E7335, respectively, both NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Mutagenesis was performed using the partial overlapping primer design method or using a Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Cell Biology 2020Quote: ... The gene fusion was then amplified using primers 20 and 21 and cloned into pClimDC linearized at the SalI restriction site using Gibson Assembly (New England Biolabs). To build pClimDC-Lifeact:mCh ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA for the Ty1 probe was amplified with primers 5’-TGGTAGCGCCTGTGCTTCGGTTAC-3’ and 5’-CATGTTTCCTCGAGTTAGTGAGCCCTGGCTGTTTCG-3’ and Phusion DNA polymerase (New England Biolabs). DNA for the Ty2 probe was generated with primers 5’-TGGTAGCGCCTATGCTTCGGTTAC-3’ and 5’-GCAATATTGTGAGCTTTTGCTGCTCTTGG-3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... We used 5 ng of each plasmid elute as PCR template and amplified out the portion of interest using 0.5 μM of primers annealing to the region of the sgrS sequence under consideration with Phusion 2X Mastermix (NEB, M0531L). We employed 20 cycles of 10 s at 98 °C denaturation ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Approximately 200−250 pmol of RNA was mixed with 400 pmol of reverse primer and 6 μL of dNTP mix (25 mM each, New England Biolabs) in nuclease-free water at a final volume of 35 μL ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR amplification was performed with primers targeting the indicated regions (Fig. 1B, Supplemental Table S1) using Taq DNA Polymerase (New England Biolabs) for 30 cycles of amplifying protocol ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification was performed using ARTIC network V3 tiled amplicon primers in two separate reactions by Q5 High-fidelity polymerase (NEB). First-round PCR products were purified using Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Microbiology 2021Quote: ... primers that contained restriction sites for BamHI and XmaI or XbaI (Table S5, primers No. 9-16 and 95-98) and the high-fidelity polymerase Q5 (New England Biolabs) according to vendor’s manual ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 μg of total RNA was depleted of rRNA using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) prior to cDNA synthesis primed with random hexanucleotide oligonucleotides (Random Primer 6, NEB). Sequencing library construction was carried out using NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: InsertTAG-pcDNA FRT/TO was created by mutagenesis of YFP-pcDNA5 FRT/TO39 to replace YFP with NheI and XhoI restriction sites using the primers ccctcgagGATATCACAAGTTTGTACAAAAAAGC (forward) and tggctagcAAACGCTAGAGTCCGGAG (reverse) and the Q5 Site-Directed Mutagenesis Kit (E0554S, New England Biolabs). BioID2-pcDNA5 FRT/TO was created by restriction digestion of BioID2 from myc-BioID2-MCS (74223 ...
-
bioRxiv - Bioengineering 2021Quote: ... 0.1 μl of each PCR reaction was amplified with index-containing primers to reconstitute the TruSeq adaptors using the Q5 High-Fidelity DNA Polymerase (New England Biolabs): (98 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μL of eluted RNA was mixed with 1 μL of 200 ng/μL random nonamer primer (New England Biolabs), incubated at 65°C for 5 minutes ...
-
bioRxiv - Plant Biology 2020Quote: ... Sequencing libraries were prepared from 300 ng of ribo-depleted RNA (NEBNext Ultra II Directional RNA Library preparation kit) and indexed with NEB Next Illumina indexing primers (NEB). An Agilent Bioanalyzer with high sensitivity DNA chip was used to confirm the quality of the libraries before they were sent for sequencing ...
-
bioRxiv - Developmental Biology 2019Quote: ... the PCR products were amplified further with the primers 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTCA-3’ and 5’-GGGGACC ACTTTGTACAAGAAAGCTGGGTC-3’ and Phusion polymerase (New England Biolabs) to add attB adapter sequences ...
-
bioRxiv - Systems Biology 2019Quote: ... and C-terminal AD was PCR amplified from pGADCg101 using forward primer AP36 (5’ GAAGGCTTTAATTTGCAAAGCTCGGGATCCGGGCCCCCCCTCGAGATCCGcatctattgaagtaat aataggcgcatg 3’) and reverse primer AP37 (5’ CAACCTTGATTGGAGACTTGACCAAACCTCTGGCGAAGAAGTCCAAAGCTctgaataagccctcgt aatatattttcatg 3’) and cloned into EcoRI (New England Biolabs, NEB) and SalI (NEB ...
-
bioRxiv - Genomics 2021Quote: ... The PCR mix (8 µl H2O, 2 µl primer mix P5Solexa/P3Solexa, 10 µM each, 20 µl Phusion HF Mix [New England Biolabs]) was added to 10 µl cDNA ...
-
bioRxiv - Genomics 2021Quote: ... a 5’ adenylated DNA oligonucleotide containing the complement of an Illumina Read 1 sequencing primer-binding site was then ligated to the 3’ cDNA end with Thermostable 5’ AppDNA / RNA Ligase (New England Biolabs). Properly ligated cDNAs were amplified by PCR (12 cycles ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Flanking primers contain 20 bp of 5’ and 3’ overlap with the pcDNA3.1 vector for Gibson Assembly (New England Biolabs, #E5510). The resulting library had an estimated complexity of 322 = 1024 codon variants and 202 = 400 amino acid variants ...
-
bioRxiv - Microbiology 2021Quote: ... pSEVA_331 and the synthetic constructs were amplified using primers in Supplementary Table S3 and Q5 DNA Polymerase (New England Biolabs), and cloned by restriction digest using the enzymes indicated in Supplementary Tables S3 and S4 ...
-
bioRxiv - Cell Biology 2021Quote: ... Approximately 50-300 ng of total RNA was used for cDNA synthesis with random primers (LunaScript SuperMix Kit, New England Biolabs), depending on the cells used ...
-
bioRxiv - Developmental Biology 2020Quote: ... and specific primers containing BstbI and XhoI restriction enzyme sites were used with Q5 high-fidelity DNA polymerase (New England Biolabs). The resulting amplicons were cut using BstbI and XhoI ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 μM of phosphorylated template oligo IF239 and 4.5 μM biotinylated primer oligo IF238 were annealed in T4 ligase reaction buffer (NEB B0202S). The mixture was heated to 75 °C for 5 min and cooled to 4 °C at a rate of −1 °C min−1 ...