Labshake search
Citations for New England Biolabs :
2301 - 2350 of 7437 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... The PCR amplicon spanning the two sgRNAs were generated with PCR using Q5 High Fidelity DNA polymerase (New England Biolabs) and the following primers:
-
bioRxiv - Bioengineering 2023Quote: ... genomic loci were amplified in a first PCR reaction (PCR-1) reaction from approximately 100 ng of gDNA using Q5 High-fidelity DNA Polymerase (NEB) and the primers listed in Sup ...
-
bioRxiv - Microbiology 2024Quote: ... The first-strand cDNA was then amplified in a PCR reaction with Phusion High Fidelity PCR Master Mix (New England Biolabs) using BRBV segment-specific primers targeting the segment termini ...
-
bioRxiv - Immunology 2024Quote: ... sgRNA guide sequences were recovered as amplicons generated by PCR of the genomic DNA using Phusion High-Fidelity PCR Master Mix with GC Buffer (M0531L, NEB) with forward (TCTTGTGGAAAGGACGAGGTACCG ...
-
bioRxiv - Microbiology 2024Quote: ... according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB). Library molarity was measured with the Qubit DNAds HS assay kit from Invitrogen and the quality was analyzed using Bioanalyzer DNA Analysis kit (Agilent ...
-
bioRxiv - Microbiology 2024Quote: ... The amplification product of pan-CoV semi-nested PCR was purified and concentrated by the Monarch PCR & DNA Cleanup Kit (NEB), according to the protocol supplied ...
-
bioRxiv - Biophysics 2019Quote: ... The PCR products were digested by DpnI (NEB) overnight at 37 °C and purified by a PCR purification kit (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR fragments were amplified using Q5 polymerase (NEB). Vectors were digested using enzymatic restriction digest and ligated to gel purified PCR products using Gibson assembly ...
-
bioRxiv - Cell Biology 2020Quote: All PCR was conducted using Phusion polymerase (NEB) using primers listed in Supplemental Table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR products were cut by BfaI (R0568S, NEB) in case of LRP5 KO and Hpy188III (R0622S ...
-
bioRxiv - Genetics 2021Quote: ... PCR was done using Q5 polymerase (M0492S, NEB). Primers used to detect the presence of amx cDNA were 5’-TCCCCGCTCTATCTGACCAA-3’ and 5’- GCTCTGTTGCCACATTTCCG-3’ ...
-
bioRxiv - Genetics 2020Quote: ... a large scale Phusion PCR (NEB, Ipswich, USA) was performed using a forward (5’-GAATTGTCTCGTTCGCAAATAC-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplifications were performed with Q5 polymerase (NEB). All other necessary enzymes were also purchased from NEB ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... six parallel PCR reactions (Q5 DNA polymerase, NEB) were set up with 30 µl of sample ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCR using Q5 DNA polymerase (New England Biolabs) instead of KAPA HiFi ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR fragments were amplified using Q5 polymerase (NEB). Vectors were digested using enzymatic restriction digest and ligated to gel purified PCR products using Gibson assembly ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR products were subsequently digested with AarI (NEB), and ligated to barcodes consisting of phosphorylated ...
-
bioRxiv - Biophysics 2019Quote: ... or pMiniT (NEB PCR cloning kit, Cat. # E1202S) plasmids and sequenced ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 1x PCR Master Mix (NEB, Cat#M0544). The samples were thermocycled at 72°C for 5 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... The Phusion Polymerase PCR protocol (New England Biolabs) was followed for preparing 50μl reactions ...
-
bioRxiv - Microbiology 2019Quote: ... PCRs were performed using Q5 polymerase kit (NEB) in a Perkin- MJ Research PTC-200 Peltier Thermal Cycler or C1000 Touch™ Thermal Cycler (BioRad) ...
-
bioRxiv - Microbiology 2019Quote: ... inverse PCR was performed using Q5 polymerase (NEB) and primers 847 and 1025 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Colony PCRs were performed with Taq polymerase (NEB). PCR products and digested plasmids were purified with the Monarch PCR & DNA Cleanup Kit (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... and purified using a PCR purification kit (NEB).
-
bioRxiv - Cell Biology 2020Quote: ... PCR product was ligated using T4 ligase (NEB) and amplified using outer primers to produce the fusion gene S1R-APEX2 ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR master mixes (NEBNext High fidelity, M0541S, NEB) containing unique barcoding primers per well were dispensed on top of the reverse crosslinking buffer and DNA was amplified with the following cycling conditions ...
-
bioRxiv - Bioengineering 2021Quote: ... were amplified by PCR using Phusion Polymerase (NEB). The amplicons and the linearized plasmid were assembled using an NEBuilder HiFi DNA assembly kit (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR products were ligated with T4 ligase (NEB). The resulting plasmid (pRG85_CM ...
-
bioRxiv - Biophysics 2020Quote: ... we PCR amplified a Lambda DNA fragment (NEB) of ~50% GC-content with the oligonucleotides 114.F RNA control 612 and 113.R RNA control 1316 ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were subsequently digested with Dpnl (NEB) to eliminate residual plasmid sequence and purified with QIAquick PCR Purification columns (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR with Phusion High Fidelity DNA Polymerase (NEB) or iProof DNA Polymerase (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was carried out using Q5 polymerase (NEB) with genomic DNA as template from their respective mutant in MKP103 background [91] and primers listed in Table S3 ...
-
bioRxiv - Plant Biology 2021Quote: ... The PCR product was ligated into NruI (NEB) digested pEAQ-HT Nicotiana benthamiana overexpression vector (Sainsbury et al. ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR products were phosphorylated with polynucleotide kinase (NEB) and circularized with T4 DNA ligase (NEB) ...
-
bioRxiv - Biophysics 2021Quote: ... PCR reaction and a KLD enzyme mix (NEB). The resulting plasmids were transformed into chemically competent DH5α cells and sequences were confirmed by Sanger double stranded DNA sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Standard PCRs were run using Taq Polymerase (NEB) using primers provided in Supplemental Table 3 ...
-
bioRxiv - Cell Biology 2021Quote: ... mCherry was PCR amplified with Q5 polymerase (NEB) using primers JM403 (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTACAATGAAAGCCTTCACACTCGCTCTC TTCTTAGCTCTTTCCCTCTATCTCCTGCCCAATCCAGCCATGGTGAGCAAGGGCGA GGAGG-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were treated with DpnI (NEB) at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... barcode PCR amplification using Q5 DNA polymerase (NEB) and Illumina adaptor-encoded primers that include unique 6-bp TruSeq indexes in the forward primer ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR amplified (Phusion DNA polymerase; New England Biolabs) and cloned into the NheI and NcoI restriction site of the AAV-EF1a-DIO-EYFP vector ...
-
bioRxiv - Biochemistry 2021Quote: ... and a Monarch PCR & DNA Cleanup kit (NEB) with the following changes ...
-
bioRxiv - Microbiology 2020Quote: ... and then PCR amplified for 20 cycles (NEB Phusion Master Mix ...
-
bioRxiv - Microbiology 2021Quote: ... all PCR reactions were performed using Phusion (NEB) with primers to add a 5’ Eco52I restriction site and a 3’ KpnI restriction site (see Supp Table 3 for oligos) ...
-
bioRxiv - Neuroscience 2022Quote: ... The PCR products were digested using DpnI (NEB) at 37°C for 90 minutes and then transformed into DH5α chemically competent cells ...
-
bioRxiv - Microbiology 2019Quote: ... PCRs used the high-fidelity Q5 polymerase (NEB) per suggested protocols ...
-
bioRxiv - Genomics 2020Quote: ... PCR fragments were treated with Nb.BbvCI nickase (NEB) before purification and ligating the Y-shape with the correct overhang ...
-
bioRxiv - Microbiology 2019Quote: ... PCR fragments were blunted using Klenow fragment (NEB) and cloned into pUC57 and sequenced.
-
bioRxiv - Molecular Biology 2020Quote: ... and PCR-amplified using the Phusion polymerase (NEB) and specifics primers flanking exon 6 of the STAU1 gene (sense ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification was done with Q5 polymerase (NEB) performed on a LightCycler 96 System (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... We used the Phusion PCR polymerase mix (NEB) containing 25 pmol each of the following two oligo sequences ...