Labshake search
Citations for New England Biolabs :
2451 - 2500 of 7437 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2019Quote: Primers for the amplification (Eurofins Genomics, Ebersberg, Germany) were phosphorylated by the T4-polynucleotidekinase/-buffer (New England Biolabs, Ipswich, USA) prior to amplification via PCR (Q5® High-Fidelity Polymerase ...
-
bioRxiv - Microbiology 2019Quote: ... The plasmid was obtained by Golden Gate cloning as follows: primers OVL1696/1697 were used to amplify pASR103 and then DpnI (NEB) treated for 1 hr at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... were amplified from genomic Synechocystis 6803 wild type DNA using specific primers (Table S1) and Phusion Polymerase (New England Biolabs). After restriction digest with BamHI and NotI ...
-
bioRxiv - Biochemistry 2020Quote: Site-directed mutagenesis was carried out by PCR amplification of the starting plasmid with forward and reverse mutagenesis primers containing the desired mutation (Table 1) followed by DpnI (NEB) treatment ...
-
bioRxiv - Genomics 2019Quote: ... NEBNext Universal PCR primer for Illumina (5’-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC-s-T-3’) and NEBNext Index primer for Illumina (NEB, index# 9-13 for five libraries in each repeat) ...
-
bioRxiv - Developmental Biology 2019Quote: ... the Cas9 site of the repair template was modified by introducing synonymous mutations either directly into the primers used for fragment amplification or separately by Q5 site directed mutagenesis kit (New England Biolabs). All DNA plasmids used for genome editing were transformed into DH5α competent cells and subsequently purified by miniprep (PureLink Quick Plasmid Miniprep Kit (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... Harvard Institute of Proteomics)(Zuo et al., 2007) using NheI and XbaI overhang primers and Phusion High-Fidelity Polymerase (NEB). A t2a-GFP backbone was subcloned from pLV hU6-sgRNA hUbC-dCas9-KRAB-t2a-GFP (Addgene plasmid #71237 ...
-
bioRxiv - Microbiology 2020Quote: The vector backbone was amplified from pMo130 using primers JMC203-JMC204 (Supplementary Table 19) with Q5 DNA polymerase (New England Biolabs), cleaned up and treated with DpnI (New England Biolabs) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... A region of the genome spanning all major reading frames and portions of the 5’ and 3’ UTRs was amplified (see Fig. S1 for primer sequences and locations) and Q5 High Fidelity DNA Polymerase (New England BioLabs) under the recommended conditions and 25 rounds of amplification ...
-
bioRxiv - Genomics 2019Quote: ... Site-directed mutagenesis for Exd and Hth was performed via amplification of the original plasmid with primers harboring single amino acid replacements (arginine to alanine) using Taq-polymerase (NEB). Double and triple mutations were generated consecutively ...
-
bioRxiv - Cell Biology 2019Quote: ... were PCR amplified using the primers pAVA0421-AAP4-FR and cloned into the pAVA0421 plasmid (Alexandrov et al., 2004) by Gibson Assembly (NEB). The fusion protein was expressed in BL21 Codon Plus (DE3 ...
-
bioRxiv - Microbiology 2021Quote: ... primers oJV5-6 were used to remove ackA from pJV204 using the Q5 site-directed mutagenesis kit (NEB CN# E0554S) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Second PCR amplification with 8 cycles was used for generating sequencing-ready libraries using NEBNext High Fidelity master mix and Illumina Universal and Index primers (E7335S, New England Biolabs) in four and twelve parallel reactions on M-280 beads for day 2 and day 8 samples ...
-
bioRxiv - Evolutionary Biology 2021Quote: We amplified pMini with different primer pairs for each mutation to be engineered (Table S5) using high fidelity Q5 polymerase (NEB). We transformed the PCR products into E.coli BW27784 cells made transformation-competent with the CaCl2 method60 ...
-
bioRxiv - Microbiology 2021Quote: ... and Bakt_805R (GACTACGVGGGTATCTAATCC)38 PCR primer pair with an individual 8 bp barcode adapter (based on the NEB Multiplex Oligos for Illumina, New England Biolabs) attached to the forward primer and the reverse primer ...
-
bioRxiv - Biochemistry 2020Quote: ... 20 pmol of the purified product was then incubated with 25 pmol of a complementary primer in 1X T4 DNA ligase buffer (NEB) supplemented with 40 μM dNTPs ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 µL of the boiled colony was used for PCR with primer pair (JGI_27F: 5’-AGAGTTTGATCCTGGCTCAG-3’and JGI_1391R: 5’-GACGGGCRGTGWGTRCA-3’) with NEB Q5 Polymerase (New England Biolabs, Ipswitch, MA). The PCR amplicon was confirmed by agarose gel electrophoresis and the sequence was determined using conventional Sanger Sequencing (Genewiz LLC ...
-
bioRxiv - Microbiology 2021Quote: ... The URA3 and 2μ components were amplified from pYES2 using primers (actatagcagcggaggggttggatcaaagtcttcctttttcaatgggtaataactga and caaccacagggttcccctcgggatcaaagtacaatcttcctgtttttggggc) using Phusion DNA polymerase (New England Biolabs) with annealing at 63°C and a 2 minute extension ...
-
bioRxiv - Microbiology 2021Quote: ... was utilized using SARS-CoV-2 specific primers[43] or SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit (New England Biolabs), which became available in assays after September 15 ...
-
bioRxiv - Microbiology 2021Quote: ... Primers listed in supplemental table 1 were annealed and ligated into the digested plasmid using T4 ligase (New England Biolabs). For the generation of pGRA1.GFP.GRA2.DHFR ...
-
bioRxiv - Bioengineering 2021Quote: ... were PCR-amplified using primers listed in Supplementary Table 7 and cloned into the px601 plasmid using an NEBuilder HiFi DNA assembly kit (NEB). Similarly ...
-
bioRxiv - Bioengineering 2021Quote: ... 2.5 μL of the digestion was PCR amplified in a 50μL reaction using 200 nM of internal primers (ipF and ipR) with the Q5® polymerase in Q5 reaction buffer with 200μM of dNTPs (NEB) with the following program ...
-
bioRxiv - Biochemistry 2021Quote: ... 700 bp upstream and downstream were amplified using the A–B and C–CD primer pairs from Table 2 (Phusion polymerase, GC buffer, New England Biolabs). The 2×myc tag was added to the B primers as overhangs ...
-
bioRxiv - Molecular Biology 2021Quote: ... cut sites found in the primers and cloned into a pcDNA3.1(+) backbone using the Quick Ligation Kit (New England Biolabs M2200). Plasmids were transformed and grown in subcloning efficiency DH5α competent cells (Invitrogen # 18265017 ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’ UTR of Pir121 was PCR amplified from genomic DNA using the primers listed in Table S2 and cloned into pPT808 [4] using Gibson assembly (NEB). All plasmids used in this study are listed in Table S3.
-
bioRxiv - Cancer Biology 2020Quote: ... WGS libraries were amplified using NEBNext® Ultra™ II Q5® Master Mix and index primers (New England Biolabs). Library purification was performed with TIANgel Midi Purification Kits (TIANGEN Biotech) ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 μl of diluted cDNA was used as template using the indicated primers in a 50 μl reaction using Phusion High Fidelity DNA Polymerase (M0530L; New England Biolabs). 15 μl of amplified DNA was used for EcoRI and BmrI restriction enzyme digestion (New England Biolabs) ...
-
bioRxiv - Evolutionary Biology 2020Quote: Deep mutational scanning libraries were generated using degenerate primers to amplify TRIM5α-HA in pQCXIP using high-fidelity Q5 polymerase (NEB). Degenerate primers contained a single NNS codon (N = A/T/C/G ...
-
bioRxiv - Biochemistry 2021Quote: ... Primer pairs were cloned by double digestion using SacI and SalI restriction enzymes (R0156, R0156, CutSmart Buffer, New England Biolabs) and ligation with T4 DNA Ligase (EL0014 ...
-
bioRxiv - Plant Biology 2020Quote: ... and uvr8-17D genotyping was through PCR amplification of a genomic fragment with a forward (5ʹ-TCG GGA TGA GAT GAT GAC-3ʹ) and a reverse primer (5ʹ-TAG ACC CAA CAT TGA CCC-3ʹ) followed by digestion with HaeIII (NEB) yielding diagnostic fragments of 344/173/145 bp for wild type and 489/173 bp for uvr8-17D.
-
bioRxiv - Plant Biology 2020Quote: ... or PCR-amplification of the target DNA sequence using primers that contain a ~20bp overlap with the entry module using high-fidelity polymerase Q5 (NEB) or GXL (Takara Bio) ...
-
bioRxiv - Systems Biology 2021Quote: ... We then amplified barcodes from cDNA using primers CPL2 and CPL7 (Supplemental Table S7) with the Q5 High Fidelity 2X Master Mix (New England Biolabs). We performed 4 PCRs per replicate from cDNA ...
-
Unraveling the functions of uncharacterized transcription factors in Escherichia coli using ChIP-exobioRxiv - Systems Biology 2021Quote: ... The DNA samples incubated for primer extension as described previously (14) were treated with dA-Tailing Module (New England Biolabs) and NEBNext Quick Ligation Module (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... were generated by PCR amplification of either full-length pfget4 or nucleotides encoding for the first 246 amino acids of PfGet2CD using PfGet4-EcoRIF (5’-GTACCGGAATTCATGAAAAAGTTCAAATTTAGTAAAGAAAAGCTAGCC-3’)/PfGet4-XhoISalIR or PfGet2CD-BamHIF (5’-GTACGCGGATCCATGGATAAAAATACATTAAAAAGAA-3’)/PfGet2CD-XhoISalIR (5’-AGACCGGTCGACCTCGAGTTATTCATGTTTCGTAATAATAAATTG-3’) primer pairs and subsequently cloning at corresponding sites in pMALc2X plasmid (New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... Heavy and light chain sequences were amplified with primers specific for the TSO handle-sequence and the respective constant region sequence with Q5 Polymerase (New England Biolabs). Following Sanger sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... resistance cassette (Khan et al., 2008) using primers corresponding to each gene either by amplification with Phusion or Q5 polymerases (NEB) and ligation or isothermal assembly ...
-
bioRxiv - Microbiology 2021Quote: ... were PCR-amplified using primers that contained restriction sites for EcoRI and SacI (Table S5, primers No. 1-6) and the high-fidelity polymerase Q5 (New England Biolabs) according to vendor’s manual ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cDNA was synthesized from 1 μg of total RNA using M-MuLV Reverse Transcriptase and Random Primers 6 (both New England Biolabs) at 42 °C for 60 min and diluted in 1:4 ratio by PCR grade water ...
-
bioRxiv - Plant Biology 2021Quote: GFP coding sequence was amplified from plasmid p2GWF7 (Karimi et al., 2002) using GFPF40 and GFPR40 primers (see Supplemental Method 2) with Phusion polymerase (New England BioLabs) according to the provider’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The gene fragment was amplified from approximately 30ng of DNA in each sample (primers in Supplementary Table 1) using a high-fidelity polymerase (NEB Q5, New England Biolabs)[27] and confirmed by 1% agarose gel electrophoresis ...
-
bioRxiv - Molecular Biology 2021Quote: ... with primers carrying the appropriate restriction enzymes sites AscI/SbfI (See Table S6 for the list of primers used) and cloned using Quick DNA Ligation Kit (NEB) into dCas9-empty-GFP vector ...
-
bioRxiv - Microbiology 2020Quote: ... single-stranded cDNA was synthesized from 10 µg of RNA using 100 pM random hexamer primer (Integrated DNA Technologies) and M-MuLV Reverse Transcriptase (New England Biolabs). After reverse transcription ...
-
bioRxiv - Cancer Biology 2021Quote: ... vector to generate the LGALS1 luciferase reporter gene (LGALS1 pGL4.23) by digesting the plasmid and the annealed primer pair using EcoRV (NEB, #R0195L) and HindIII (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... The open reading frame for a KIF18A wild-type siRNA resistant construct51 and pEM791 vector49 were amplified with primers designed for Gibson Assembly (New England BioLabs). After confirming the correct sequence of the Gibson assembled plasmid ...
-
bioRxiv - Molecular Biology 2022Quote: 1 μg of total RNA was used to synthesize cDNA with dTALE gene specific primer dTALE-GSP_R0 (cgacttgagcagcaggagatgc) using the ProtoScript®II first strand cDNA synthesis kit (New England Biolabs) according to the manufacturer’s manual ...
-
bioRxiv - Genetics 2022Quote: ... Libraries were amplified using NEBNext Ultra II Q5 polymerase and unique combinations of primers from the NEBNext Multiplex Oligos for Illumina (NEB). The following amplification protocol was used ...
-
HNRNPA2B1 controls an unfolded protein response-related prognostic gene signature in prostate cancerbioRxiv - Cancer Biology 2022Quote: ... was combined with forward and reverse primers (Supplementary Table 3) and the Luna Universal qPCR Master Mix master mix (M3003, NEB) containing SYBR green and ROX passive dye to a final 10ul reaction volume ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μl of each PCR reaction was amplified with barcoded primers to reconstitute the TruSeq adaptors using the Phusion High Fidelity DNA Polymerase (New England Biolabs): (98°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Reverse transcription of 50 ng total RNA was performed using Protoscript II First Strand cDNA Synthesis Kit with oligo(dT)23 primers (NEB). cDNA was undiluted ...
-
bioRxiv - Genetics 2022Quote: ... total RNA was reverse transcribed using a primer specific for library mRNA (TE121) and the Protoscript II reverse transcriptase (NEB). Following reverse transcription ...