Labshake search
Citations for New England Biolabs :
2751 - 2800 of 7437 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed using Q5 polymerase (New England Biolabs) according to manufacture instructions ...
-
bioRxiv - Genomics 2020Quote: ... was amplified in 50μl PCR reactions with Q5 (NEB) using 25ng plasmid template and EF05 and EF06 primers ...
-
bioRxiv - Genomics 2020Quote: ... was amplified in 50μl PCR reactions with Q5 (NEB) using 25ng plasmid template and EF07 and EF08 primers ...
-
bioRxiv - Microbiology 2020Quote: ... Synthesized DNA was amplified by PCR (NEB Q5 polymerase) and cloned into pDONR/Zeo (Thermo ...
-
bioRxiv - Plant Biology 2020Quote: PCR amplification with PHUSION High-Fidelity Polymerase (NEB, M0535S) or Q5 High-Fidelity DNA Polymerase (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR was performed using Phusion polymerase (New England Biolabs) using a 90 second elongation for 35 cycles ...
-
bioRxiv - Cell Biology 2020Quote: ... Amplification was performed by PCR using Q5 polymerase (NEB) for 26-28 cycles using primers carrying dual indexes as previously described15 ...
-
bioRxiv - Microbiology 2022Quote: ... All PCR reactions were done using Q5 polymerase (NEB). Primers used and knockouts constructed are described in Supplementary Tables 9 and 10 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 25 µl NEBNext HiFi 2x PCR Master mix (NEB) was added to each ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed with the Taq DNA Polymerase (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were treated with DpnI (NEB, R0176) at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... The resultant PCR products were introduced into NheI (NEB) linearized ToxoXpress vector (pTXP ...
-
bioRxiv - Microbiology 2022Quote: ... The amplified PCR product was digested by BamHI (NEB) and NotI (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... and purified using Monarch PCR clean-up kit (NEB). Blunted DNA was A-tailed using NEBNext dA-tailing kit (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... and plasmid was PCR-linearized by Q5 polymerase (NEB) using primers (IDT ...
-
bioRxiv - Biophysics 2022Quote: ... and Q5 High-Fidelity PCR Kit (New England BioLabs). Plasmids were transformed in E ...
-
bioRxiv - Microbiology 2020Quote: PCR reactions were carried out using Phusion polymerase (NEB) according to the manufacturer’s recommendations with the following primers ...
-
bioRxiv - Genomics 2021Quote: ... PCR was done with the Phusion DNA polymerase (NEB), using the following program ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were digested with DpnI (New England BioLabs) overnight at 37°C and purified using Qiagen PCR Purification kit ...
-
bioRxiv - Biochemistry 2021Quote: ... and SETD2 were constructed by PCR (Phusion polymerase, NEB) using a full-length version of the constructs ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR was performed using Phusion high-fidelity polymerase (NEB) to add a T7 promoter sequence with custom primers (forward ...
-
bioRxiv - Microbiology 2022Quote: PCR amplicons were purified using Thermolable Exonuclease I (NEB), diluted at a ratio of 1:2 and amplified following the Nextera XT Index protocol (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... and PCR was performed using Q5 polymerase (NEB; M0491L) with primers that had 500 bp homology to both KPPR1S and MKP103 on either end of the transposon cassette ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Enzymes for PCR and cloning were purchased from NEB. Plasmids were cloned into either Top10 E ...
-
bioRxiv - Synthetic Biology 2019Quote: ... by PCR (NEB, Q5® High-Fidelity DNA Polymerase). The other promoters (PALD4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The substrates were amplified using Phusion Polymerase PCR (NEB). The linear double-stranded molecules were denatured and renatured to produce both the parental linear molecules and a circle with nicks on each strand nearly half-way around the circle which were then ligated by Taq Ligase (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: PCR products were run alongside 100bp ladder (NEB, N3231L) on a 1.2% agarose gel prestained with SYBR Safe (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... PCR amplification was performed using a Q5 polymerase (NEB) and an CH1-specific reverse primer (5’ATGGAGTCGGGAAGGAAGTC’3 (Ozawa et al. ...
-
bioRxiv - Bioengineering 2020Quote: ... Q5 High-Fidelity PCR Kit was purchased from NEB.
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR products were first treated with DpnI (NEB, R0176) and T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR-reaction was treated with DpnI (NEB CutSmart) to get rid of the template DNA ...
-
bioRxiv - Systems Biology 2021Quote: ... using 2X NEBNext High-Fidelity PCR Master Mix (NEB). For sequencing ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Both PCR reactions were digested with DpnI (NEB, USA) for one hour at 37°C and then purified using the MagJET NGS Cleanup Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... PCR amplification was conducted using Phusion HF reagents (NEB) and employed the following cycling conditions ...
-
bioRxiv - Genetics 2020Quote: PCR mixture per reaction: 10 µl HF Buffer (NEB), 1.25 µl 10-µM forward primer ...
-
bioRxiv - Systems Biology 2019Quote: ... The PCR reaction was digested with 10U DpnI (NEB) for 1h at 37°C and purified by ethanol precipitation ...
-
bioRxiv - Molecular Biology 2020Quote: PCR-1 reactions were performed using Q5 Polymerase (NEB) in a 20 μl reaction containing 200 μM dNTPs ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were digested with BsaI (New England Biolabs) followed by gel purification and ligation into respective entry vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was PCR amplified with Phusion polymerase (NEB #M0531S), run on an agarose gel ...
-
bioRxiv - Microbiology 2020Quote: ... All PCR reactions were conducted using Phusion polymerase (NEB) according to the manufacturer’s instructions with GC buffer ...
-
bioRxiv - Microbiology 2021Quote: ... PCR amplifications were made with Phusion polymerase (NewEngland Biolabs) under the standard reaction protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR product was purified on silica columns (NEB T1034) and assembly with Nluc_HBB_3UTR fragment was performed as described above for initial preparation of IVT template using HBB29_N35 amplicon ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR product was purified on silica columns (NEB T1034) and amplified with under the following conditions ...
-
bioRxiv - Genetics 2020Quote: ... and 3 cycle barcoding PCR is performed (NEB, E7645S). 2×150bp paired end sequencing data is generated on Illumina HiSeq 4000 at Novogene.
-
bioRxiv - Genetics 2020Quote: ... and 3 cycle barcoding PCR is performed (NEB, E7645S). 2×150bp paired end sequencing data is generated on Illumina HiSeq 4000 at Novogene.
-
bioRxiv - Cell Biology 2019Quote: ... PCRs were performed using Taq Polymerase (NEB standard protocol) and the following amplification conditions ...
-
bioRxiv - Genetics 2020Quote: ... The HeLa Deletion Reporter required PCR with OneTaq (NEB) using the high GC content additive to amplify through the very GC-rich CAG sequence ...
-
bioRxiv - Microbiology 2019Quote: ... PCR was performed using Phusion High Fidelity polymerase (NEB) after which PCR products were run on a 1.2% or 2% agarose gel ...
-
bioRxiv - Microbiology 2021Quote: ... The backbone PCR products were subjected to DpnI (NEB) digestion ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were prepared with OneTaq Master-mix (NEB) in 96 well plates to a final volume of 20μl ...