Labshake search
Citations for New England Biolabs :
2451 - 2500 of 4002 citations for Hexadecanoic acid reaction products with tetraethylenepentamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... GFP and taCA were cloned by polymerase chain reaction (PCR) using pMAL-c5X (New England Biolabs, USA), pGEX-4T-1 (GE Healthcare ...
-
bioRxiv - Bioengineering 2021Quote: ... the PCR reaction was purified via Monarch® DNA Gel Extraction Kit (New England Biolabs® Inc.). Plasmids were constructed via the Hot Fusion Assembly Method (Fu et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR reactions were performed in 20μl total volume with Luna Universal qPCR Master Mix (New England Biolabs). Target genes and reference controls were analysed in duplicate reactions for all samples ...
-
bioRxiv - Biophysics 2021Quote: ... Reactions of 100 µL volume were prepared using the PURExpress Δ Ribosome Kit (New England Biolabs, E3313S) containing 0.8 U/µL of SuperASE-In ...
-
bioRxiv - Plant Biology 2020Quote: ... and adapter ligation were carried out in reduced-volume reactions (0.25x for KAPA and 0.5x for NEB) to reduce costs ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were set up with 1 μL of genomic DNA and either Q5 DNA Polymerase (NEB) or LongAmp Taq (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were performed with the Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs) with 100 ng of genomic DNA ...
-
bioRxiv - Microbiology 2021Quote: ... Two microlitres of this reaction was then used as template for PCR using Taq DNA polymerase (NEB), DNA oligo E4 (CSO-4720) ...
-
bioRxiv - Microbiology 2020Quote: ... The reverse transcription reaction (20 μL) contained 2 μL 10x M-MulV buffer (B0253S, New England Biolabs), 1 μL of 50 μM Oligo 18 dT (SO132 ...
-
bioRxiv - Plant Biology 2021Quote: ... The optimal 25-μL reaction included 2.5 μL 10× ThermoPol buffer (New England Biolabs, Ipswich, Massachusetts, USA), 2.25 μL each of FIP and BIP (1.8 μM) ...
-
bioRxiv - Cell Biology 2020Quote: ... samples were incubated in a final volume of 40μL containing 1X G5 reaction buffer (New England BioLabs) and incubated at 37°C for 4 hrs in the absence (mock ...
-
bioRxiv - Genomics 2022Quote: Beads were resuspended in 80 µl T4 PNK reaction mix (3 µl T4 PNK (NEB cat# M0201B), 97.2 mM Tris pH 7 ...
-
bioRxiv - Biochemistry 2022Quote: ... the reactions were subjected to RNase H cleavage by incubation with Thermostable RNase H (New England Biolabs) at a final concentration of 0.5 U/µL at 37°C for 1 h.
-
bioRxiv - Microbiology 2022Quote: ... The PCR reaction to simultaneously amplify all eight gene segments was performed using Phusion polymerase (NEB #M0530L) as follows ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleavage reactions were initiated by the addition of 34.82 fmol of linearized plasmid (digested with HindIII (NEB)) and buffer to bring the total reaction volume to 22.5 μL with a final composition of 10 mM HEPES pH 7.5 ...
-
bioRxiv - Microbiology 2022Quote: ... Parallel T7 reactions performed at the same time used 1.25 μg XbaI linearised pT7HCV(5’+)341N79wt and pT7HCV(5’+)341N79ko as templates in a 25μl final reaction volume containing 2.5μl 10 x T7 transcription buffer (NEB), 0.6μl RNaseOUT ...
-
bioRxiv - Cell Biology 2022Quote: ... Each reaction contained 4 µL of 2X Luna Universal qPCR Master Mix (New England Biolabs, cat#M3003E), 0.4 µL of each 20X primer assay ...
-
bioRxiv - Cell Biology 2022Quote: Each reaction contained 4 µL of 2X Luna Universal qPCR Master Mix (New England Biolabs, cat#M3003E), 0.4 µL of each 20X primer assay ...
-
bioRxiv - Microbiology 2022Quote: 50 μl PCR reactions were performed using Q5 Hot start High-Fidelity DNA polymerase (New England Biolabs), PJF119EH-cusF (pAV54 ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed and phosphorylated sgRNA (1:10) and T4 Ligase reaction buffer (1:10, #B0202S, New England Biolabs) with 10 mM 10x Adenosine 5’-Triphosphate (#P0756S ...
-
bioRxiv - Microbiology 2020Quote: ... This resulting reaction was then transformed into NEB5α competent cells using the manufacturer’s instructions (New England Biolabs). Plasmid constructs were verified via restriction digests and Sanger sequencing ...
-
bioRxiv - Developmental Biology 2022Quote: ... was used in the NEBNext UltraII End Prep reaction with the End Prep Enzyme Mix (NEB, E6050L) and incubated for 30 minutes at 20C followed by 30 minutes at 65C ...
-
bioRxiv - Microbiology 2022Quote: ... For the noncapped assay the RNA in the reaction was treated with T4 PNK (NEB, Ipswich, MA) to produce a pool of 5’ monophosphate RNAs ...
-
bioRxiv - Evolutionary Biology 2022Quote: PCR reactions were done with the Phusion high fidelity DNA polymerase (New England Biolabs Canada, Whitby Ontario) using standard protocols ...
-
bioRxiv - Genomics 2022Quote: ... All PCR reactions were performed using Q5® Hot Start High-Fidelity 2X Master Mix (NEB, M0494S). The in vitro transcription of VRQR-ABE7.10max mRNA reaction contains 50 ng/μL linearized VRQRABE-mRNA DNA template ...
-
bioRxiv - Genetics 2020Quote: ... was destroyed by incubating the reactions with Exonuclease I at 37°C (New England Biolabs, MA. USA). After exonuclease inactivation at 80°C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All PCR reaction were carried out using the Q5® High-Fidelity DNA Polymerase (New England Biolabs) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2020Quote: ... The UMI adapters ligation reaction contained 50 µL Blunt/TA ligation Master mix (New England Biolabs, USA), 20 µL adaptor mix prepared above and 1 µg end-repaired DNA in 80 µL nuclease free water ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... and selection cassette (either NeoR or HygroR) were assembled in one reaction using NEBuilder HiFi kit (NEB) in pMK289 backbone [3] ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA pellets were resuspended in 5 µL dephosphorylation reaction mix (7 mM Tris pH 8, 1x NEB T4 PNK buffer ...
-
bioRxiv - Microbiology 2021Quote: ... Reactions were carried out with a total volume of 50ul using Phusion DNA polymerase (New England Biolabs). Amplified products were then run on 1% agarose gel to verify the presence of the amplicon and all samples were pooled and purified using the GeneJet PCR Purification Kit (Fisher) ...
-
bioRxiv - Microbiology 2021Quote: ... All PCR reactions were carried out with Phusion® High-Fidelity PCR Master Mix (New England Biolabs). Mix same volume of 1×loading buffer (contained SYBR green ...
-
bioRxiv - Immunology 2021Quote: ... The reaction was purified using a PCR clean-up kit according to manufacturer’s directions (NEB, Cat#: T1030S) or using ExoSAP-IT ...
-
bioRxiv - Genomics 2021Quote: ... The PCR fragments were recombined to the vector in 50 parallel NEBuilder HiFi DNA assembly reactions (NEB) according to the manufacturer’s instructions using 150 ng of linearized vector and 50 ng of custom CpG-free adapter-ligated genomic DNA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... All PCR reactions were carried out with Phusion® High-Fidelity PCR Master Mix (New England Biolabs), and the mixture PCR products were purified with GeneJET Gel Extraction Kit (Thermo Scientific) ...
-
bioRxiv - Evolutionary Biology 2021Quote: Mutagenesis and related PCR reactions were performed using Q5 High-Fidelity DNA Polymerase (New England Biolabs, #M0491). The mutant A3G library was constructed via multi-site saturation mutagenesis of codons 128 and 130 using NNS degenerative codons (N = A ...
-
bioRxiv - Genetics 2021Quote: ... The ligation reaction was purified by magnetic beads and digested with 40 units of XcmI (#R0533S; NEB) for 3 h ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µl from the supernatant was used for a 20 µl PCR reaction with Phusion polymerase (NEB), using primers oLGB21 (TGGGAGCAAGTTTTCTGAATTTGG ...
-
bioRxiv - Microbiology 2021Quote: ... 20 μL qPCR reactions were prepared using the LUNA® Universal qPCR Master Mix (New England Biolabs), together with 2.5 μL of ChIP DNA (1:10 ...
-
bioRxiv - Microbiology 2021Quote: ... All fragments were amplified by polymerase chain reaction (PCR) using Q5 DNA polymerase (New England Biolabs, USA). Fragments to be ligated contained regions of 20-30 bp of homology ...
-
bioRxiv - Genomics 2021Quote: ... 25 ul PCR reactions were prepared with LongAmp Taq 2x Master Mix (New England Biolabs, Inc; M0287L) and 0.4 uM of each primer ...
-
bioRxiv - Genomics 2021Quote: ... first-level PCR reactions were performed using 1μl PCR-compatible lysate as a template for a 6.25μl Q5 (NEB) PCR reaction according to the manufacturer’s protocol (annealing temperature ...
-
bioRxiv - Genomics 2021Quote: ... PCR reaction according to the manufacturer’s protocol (annealing temperature: 60°C; elongation time: 15sec, 19 cycles) (NEB). Of this reaction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and quick change PCR reactions were performed using Vent DNA polymerase (purchased from New England Biolabs, NEB) and oligonucleotide primers purchased from Eurofins Genomics ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and quick change PCR reactions were performed using Vent DNA polymerase (purchased from New England Biolabs, NEB) and oligonucleotide primers purchased from Eurofins Genomics ...
-
bioRxiv - Immunology 2023Quote: ... PCR reactions were performed using OneTaq Quick Load 2X Master Mix with Standard Buffer (New England Biolabs). Detection of Mincle-specific cDNA was conducted by PCR with the same gene-specific primers described in the previous section (Suppl ...
-
bioRxiv - Molecular Biology 2023Quote: ... The ligation mix (20 μl) was added to a 50 μl reaction containing 1X thermopol buffer (NEB), 200 μM each of dATP ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR reactions were carried out using Q5 High Fidelity Hot Start DNA Polymerase (New England Biolabs (NEB), UK) ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR reactions were carried out using Q5 High Fidelity Hot Start DNA Polymerase (New England Biolabs (NEB), UK) ...
-
bioRxiv - Genomics 2023Quote: ... Reverse transcription reactions (RT +) were then performed with 5 µg of RNA and random hexamers (NEB, #S1330S), using the Superscript III Reverse Transcriptase (Thermo Fisher Scientific ...