Labshake search
Citations for New England Biolabs :
2701 - 2750 of 4002 citations for Hexadecanoic acid reaction products with tetraethylenepentamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... IVT_T7_Forward and reverse primers were added to the product and PCR amplified using LongAmp Taq 2X Master Mix (NEB, M0287S) with the following cycling conditions ...
-
bioRxiv - Molecular Biology 2022Quote: ... This PCR product was then introduced in MluI linearized pCRIS-PITChv2 vector via NEBuilder 2× HiFi assembly (New England Biolabs). Primers containing 20 to 22 bp homology regions corresponding to the genomic locus 5’ and 3’ of the sgRNA cleavage were used to PCR this cassette ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were cloned into the NdeI-BamHI sites of pGBKT7 or pGADT7 vectors using NEBuilder (New England BioLabs, USA).
-
bioRxiv - Cancer Biology 2024Quote: ... The sequencing library was generated by combining equal amounts of purified PCR products and quantified using the NEBNext Library Quant Kit for Illumina (New England Biolabs). The primer 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGTGGAAAGGACGAAACACCG-3’ was used to sequence on Illumina platforms.
-
bioRxiv - Molecular Biology 2024Quote: ... To do this 2.5 uL of cutsmart buffer was added to 20 uL of purified PCR product and then 1 uL of DpnI (NEB) was added ...
-
bioRxiv - Molecular Biology 2024Quote: The golden gate assembly reaction was assembled in a PCR tube by mixing 100 ng of the vector with a 3 fold molar excess of the purified PCR product (calculated using the NEB bio calculator ...
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were genotyped by sequencing PCR products using primer vangl2 fwd 5’-ATTCCCTGGAGCCCTGCGGGAC-3’ and primer vangl2 rev 5’-AGCGCGTCCACCAGCGACACAGC-3’ or restriction digest of the PCR products with Alu1 (R0137S, NEB). The vangl2 wild type allele stayed intact while the vangl2vu67 mutant allele was identified by a digested PCR product.
-
bioRxiv - Plant Biology 2024Quote: ... A 517bp product was amplified using the primers specified in Table S4 and S5 and digested with BsaI-HFv2 (NEB) according to the manufacturer’s guidelines before gel electrophoresis of the resulting product on 3% agarose gel ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl from the PCR product were circularized using 1 µl T4 DNA ligase and 2 µl ligation buffer 10x (NEB) in a final volume of 20 µl ...
-
bioRxiv - Bioengineering 2024Quote: ... anchored primer was used to create a complementary strand to the TdT extended products using 15 units of Klenow Fragment (3′→5′ exo-) (NEB) in 1× NEB2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL of the DNAse digestion product was then treated with 1 μL of Proteinase K (New England Biolabs, P8107S) in UltraPure water for a total reaction volume of 20 μL ...
-
bioRxiv - Neuroscience 2024Quote: ... Subcloning PCR product and pEGFP-C1 backbone were cut using Kpn1-HF and Spe1-HF restriction enzymes (New England BioLabs) and ligated using Quick Ligase Kit (New England BioLabs ...
-
bioRxiv - Plant Biology 2024Quote: ... each genomic segment was amplified as two PCR products and cloned in the pDIVA backbone (Wetzel et al., 2018) using the NEBuilder HiFi DNA Assembly kit (NEB). The CP-RT ORF (without viral UTRs ...
-
bioRxiv - Neuroscience 2024Quote: Total RYR1 transcripts were amplified as 7 overlapping PCR products.38 They were sequenced after fragmentation and library preparation using NEBNEXT NGS workflow (New England Biolabs) according to manufacturer recommendation ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were used to constructed libraries using NEB Next Ultra DNA Library Prep Kit for Illumina (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Genomics 2024Quote: ... Resulting dsDNA was purified using a 1X SPRIbead clean-up within the 96-well plate, and the resulting product was subjected to USER digestion (80% ddH2O, 10% 10X rCutsmart, 10% USER enzyme (NEB)) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 µg of purified DNA (PCR product after 2nd round PCR after selections) was incubated with PstI-HF (New England Biolabs) at 37 °C for 1 h ...
-
bioRxiv - Developmental Biology 2023Quote: ... The mCherry-Trim21 fragment was PCR amplified (Phusion high fidelity DNA polymerase, MO530S) to introduce ClaI restriction sites (fwd TAATTATCGATTATAATGGTGAGCAAGGGCGAGGA, rev TATTAATCGATCCGCTCACATCTTTAGTGGACAGA) The PCR product was purified (NEB Monarch PCR and DNA purification kit ...
-
bioRxiv - Developmental Biology 2023Quote: ... The Sox2(600bp)::GFP plasmid was generated by digesting the primer overhangs of the PCR product with XhoI and EcoRV (NEB) and its consequent ligation into linearised plasmid ISceI/MCS-d1GFP-SV40/ISceI ...
-
bioRxiv - Genetics 2023Quote: ... Single-stranded RNA was synthesized from the PCR product using Hiscribe T7 Quick High Yield RNA Synthesis Kit (E2050S, NEB). The ssRNA was then converted into ssDNA using Maxima H Minus Reverse Transcriptase (EP0753 ...
-
bioRxiv - Neuroscience 2023Quote: ... which were in vitro transcribed with the mRNA products being capped and polyadenylated by using HiScribe T7 ARCA mRNA Kit (New England Biolabs). mRNA products were column-purified (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: ... The guide RNA target site was amplified from transfected cells and PCR products were analyzed by T7 Endonuclease I digestion (New England Biolabs) or Sanger sequencing followed by ICE analysis (Synthego ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 bp Cy3‐UTP labeled RNA was generated using a PCR‐product containing a T7‐promoter site and the HighScribe T7 high yield RNA synthesis kit (NEB) as well as Cy3‐UTP (Jena Bioscience) ...
-
bioRxiv - Microbiology 2023Quote: ... difficile VPI10463 and UK1 strains and purified PCR products were directly cloned into the pMSR0 vector using NEBuilder HiFi DNA Assembly (New England Biolabs). The pMSR0-derived plasmids containing the allele exchange cassettes of the target genes were transformed into E ...
-
bioRxiv - Biochemistry 2023Quote: ... The duplex hRNase 4 cleavage products (5′ fragments of the RNA) were enriched using Hydrophilic Streptavidin Magnetic Beads (New England Biolabs). The beads were washed twice by a high salt buffer (5 mM Tris HCl ...
-
bioRxiv - Biochemistry 2023Quote: The other plasmids described in Table 1 were generated by insertion of point mutations or stop codons using the high fidelity Phusion polymerase (product #M0530L; New England Biolabs), and verified by sequencing ...
-
bioRxiv - Bioengineering 2023Quote: The PCR reaction was performed and the resulting PCR product as well as PCDH-mNeonGreen-MCS-T2A-puromycin plasmid were cleaved with BamH1(NEB) and Not1(NEB ...
-
bioRxiv - Microbiology 2023Quote: ... plasmids and PCR products would be digested with the corresponding restriction enzymes and ligated together with T4 DNA ligase (New England Biolabs). The ligated plasmid would be transformed into E ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µl of the Dpn I digested amplification product was transformed into 25 µl of NEB turbo competent E.coli (NEB, C2984). The desired mutation was initially confirmed by Sanger sequencing (Genomics Core Facility (UPF ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 10 ng of the intermediate plasmid products were incubated with 10 uM random hexamer primers and 1X phi29 DNA polymerase buffer (NEB) at 95°C for 3 minutes and then cooled to room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting PCR products as well as Borrelia shuttle vector pBSV2-G were digested with XmaI and XbaI and the resulting PCR product and pBSV2-G backbone were ligated together using T4 DNA Ligase (New England Biolabs), followed by subsequent transformation into E ...
-
bioRxiv - Genomics 2022Quote: ... After 25 cycles of amplification the product was purified with the Monarch PCR&DNA Cleanup kit (New England BioLabs T1030L) and eluted with 20 μl of ddH2O ...
-
bioRxiv - Biochemistry 2022Quote: ... 100 ng of each gel-purified PCR products (total of 19) were mixed and digested with BsmBI restriction enzyme (NEB) for 2 h at 55 °C ...
-
bioRxiv - Cancer Biology 2022Quote: PCR products were amplified from the specified genomic DNA samples with Q5 High-Fidelity 2X Master Mix (New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... The PCR products were purified and cleaned using a Monarch® PCR & DNA cleanup kit (New England BioLabs, Ipswich, MA). RNAs for the in vitro test were transcribed using a HiScribe™ T7 high yield RNA synthesis kit (New England BioLabs ...
-
bioRxiv - Bioengineering 2022Quote: pGRNA-sacB-endA was cloned by PCR-amplification of pGRNA-sacB-ccdB using primers 542 and 543 and subsequent circularization of the PCR product by Gibson assembly (New England Biolabs).
-
bioRxiv - Cell Biology 2022Quote: ... pDRF1-GW eCFP was made by performing a PCR with KOD One™ PCR Master Mix on AKAR3-EV with FW primer 5′-ATGCTAGCATGGTGAGCAAGGGCG-3′ and RV primer 5′-TAGCGGCCGCTTACTTGTACAGCTCGTCCATGCCG −3′ after which the PCR product and pDRF1-GW were digested using NheI-HF and NotI-HF (New England Biolabs). Finally ...
-
bioRxiv - Immunology 2022Quote: ... Resulting mRNA products were capped with a 5’-Cap 1 structure using vaccinia capping enzyme (New England Biolabs, Ipswitch, MA) and Vaccinia 2’ O-methyltransferase (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2022Quote: ... aeruginosa AZPAE12409 was inserted into pBL1MBPG2L4 RT-8XHis by PCR amplifying a 658-bp region of genomic DNA containing the Direct Repeats with Gibson forward and reverse primers that append flanking KpnI sites and inserting the KpnI-digested PCR product into the KpnI site of pBL1-MBPG2L4 RT-8XHis by using NEBuilder HiFi DNA Assembly (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Illumina multiplex and bar code primers were added by PCR (1 µL of MMEJ product and 200 nM primers in Phusion High-Fidelity PCR Master Mix (New England Biolabs) with 98°C ...
-
bioRxiv - Microbiology 2022Quote: ... then 3’-adenylated and NEXTflex HT Barcodes (Bio Scientific Corporation) were added using NEBNext DNA modules products (New England Biolabs). After two consecutive cleanups with 1×AMPure XP ...
-
bioRxiv - Microbiology 2022Quote: ... The sequencing ladders were obtained from hlgCB or hlgB PCR products (amplified with primers listed in Supplementary Table S2) and the Vent (exo-) DNA polymerase (NEB Biolabs). All samples were fractionated on a 10% polyacrylamide −8 M urea gel in 1x TBE ...
-
bioRxiv - Microbiology 2022Quote: ... We then ligated the purified sroA or sroB PCR product digests with the purified pEB355 or pEB354 EcoRI / BamHI digests using the Instant Sticky End Ligase (New England Biolabs) and transformed them into chemically competent NEB-5α cells (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... washed with and resuspended into 1 ml PBS and incubated with 33 nM human neutrophil elastase (hNE, Elastin Products) or proteinase K at 20 μg/ml (NEB) at 37 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... The digested plasmid and the PCR product were then assembled with NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs). Chemically competent Stbl3 Escherichia coli cells (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... each 10 μL of double stranded PCR products were treated with 5 units Lambda exonuclease enzyme (New England Biolabs, NEB) at 37 °C for 45 min which is followed by 10 min at 75 °C for enzyme inactivation.
-
bioRxiv - Molecular Biology 2023Quote: ... each 10 μL of double stranded PCR products were treated with 5 units Lambda exonuclease enzyme (New England Biolabs, NEB) at 37 °C for 45 min which is followed by 10 min at 75 °C for enzyme inactivation.
-
bioRxiv - Microbiology 2023Quote: ... We ordered DNA primers from Integrated DNA Technologies and then amplified PCR products using either Q5 Hot-Start Master Mix (#M0494S, New England Biolabs) or KOD XL (#71087-3 ...
-
bioRxiv - Immunology 2022Quote: ... 2 µl preramp PCR product was mixed with 48 µl tagging PCR mix (10 µl 5x phusion HF buffer (NEB); 1 µl Phusion Hot Start II DNA Polymerase (2U/ µl ...
-
bioRxiv - Genetics 2023Quote: ... we constructed the NGS library using the products from the last step following the NEBNext Small RNA Library Prep Set for Illumina (New England BioLabs) protocol ...