Labshake search
Citations for New England Biolabs :
2201 - 2250 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Individual fragments were amplified at 60°C with Phusion® High-Fidelity Polymerase (New England Biolabs) using T ...
-
bioRxiv - Microbiology 2019Quote: ... pSW068 and pSZT025 vectors were amplified using Q5® High-Fidelity DNA Polymerase (New England Biolabs) according to manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Polymerase chain reactions (PCRs) were conducted using Q5 High-Fidelity 2x Master Mix (New England Biolabs) in the presence of 0.5 µM of forward and reverse primers in a volume of 25 µL ...
-
bioRxiv - Synthetic Biology 2019Quote: ... KAPA HiFi HotStart ReadyMix (KAPA Biosystems, or Q5 High-Fidelity 2X Master Mix (New England Biolabs), 60 nt primer sequences containing 20 nt amplification primer sequences and 40 nt ITRs (to be used during bulk suppression PCR) ...
-
bioRxiv - Developmental Biology 2019Quote: ... The PCRs was made using the Q5 High-Fidelity polymerase from New England Biolabs (NEB, M0492L).
-
bioRxiv - Plant Biology 2020Quote: ... were PCR amplified using Q5® High-Fidelity DNA Polymerase (New England Biolabs, Cat n° M0491) with oligonucleotide primers containing attB recombination sequences ...
-
bioRxiv - Developmental Biology 2020Quote: ... The bcd-3’UTR was PCR amplified using Q5 high-fidelity polymerase (New England Biolabs, M0491S) from genomic DNA using the primers 5’-GAGTCATCA-TCATCAGTTTCGTCAAAAGTAACCTGGATGAGAGGCGTGTTAGAG-3’ and 5’-CTGGGTCG-GCGCGCCCACCCTTGTCTAGGTAGTTAGTCACAATTTACCCGAGTAGAGTAG-3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA fragments were PCR amplified using Q5® Hot Start High-Fidelity 2X Master Mix (NEB) and oligonucleotides described in Supplementary Table 2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Target genes were PCR amplified from genomic DNA using Phusion® High-Fidelity DNA Polymerase (NEB) and propagated following the instructions of CloneJET PCR Cloning Kit (Thermo) ...
-
bioRxiv - Synthetic Biology 2019Quote: All PCRs were performed using the Q5 Hot Start High-Fidelity Polymerase (New England Biolabs, NEB). PCR products were analysed on 1-2 % TAE or TBE agarose gels ...
-
bioRxiv - Synthetic Biology 2019Quote: All PCRs were performed using the Q5 Hot Start High-Fidelity Polymerase (New England Biolabs, NEB). PCR products were analysed on 1-2 % TAE or TBE agarose gels ...
-
bioRxiv - Genomics 2019Quote: ... 20 ng of the forward backbone was amplified with Len_lib_linF and Len_lib_linR (Supplemental Table 8) using NEBNext High-Fidelity 2X PCR Master Mix (NEB); the minimal promoter and GFP was amplified from 10 ng of the pLS-mP plasmid using minGFP_Len_HAF and minGFP_Len_HAR (Supplemental Table 8) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed on the cDNA using high-fidelity DNA polymerase (New England Biolabs Phusion polymerase) using a forward primer targeting the start of rimA (PFLU0263 ...
-
bioRxiv - Microbiology 2021Quote: ... Candidate genes or operons were PCR amplified using Q5 high fidelity DNA polymerase (New England Biolabs) according to manufacturer’s instructions using primers (No ...
-
bioRxiv - Biochemistry 2020Quote: ... The polymerase chain reaction (PCR) included 1-unit Phusion High-Fidelity DNA Polymerase (New England Biolabs), 1x Phusion buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR was performed with Q5 Hot Start High-Fidelity 2 × Master Mix (#M0494L, New England Biolabs) with the amount of input genomic DNA (gDNA ...
-
bioRxiv - Genomics 2021Quote: ... were amplified from TX1072 genomic DNA with Q5®High-Fidelity DNA Polymerase (New England Biolabs) and restriction sites for NdeI/XhoI and EcoRI/PmeI were included in the 5’ and 3’ primers (PK47 ...
-
bioRxiv - Immunology 2021Quote: ... PCR reactions were carried out in quadruplicate using Q5 High-Fidelity DNA Polymerase (NEB, Ipswich, MA). Each PCR reaction contains 0.5 uM of each primer ...
-
bioRxiv - Immunology 2020Quote: ... 1μl was used for the Phusion High-Fidelity DNA Polymerase PCR reaction (New England Biolabs, USA) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... All PCR amplifications were performed using a high-fidelity polymerase (Q5 DNA polymerase, New England Biolabs) to avoid PCR introduced sequence error.
-
bioRxiv - Genetics 2020Quote: ... using 12.5 µL of Phusion® High-Fidelity PCR Master Mix NEB (New England Biolabs Inc.), and 2 µl of Illumina forward and reverse [10 µM] primers ™ ...
-
bioRxiv - Genetics 2020Quote: ... Gene amplification reactions were performed using Phusion® High-Fidelity PCR Master Mix (New England Biolabs). Sanger sequencing (Genewiz ...
-
bioRxiv - Genomics 2021Quote: ... Each well contained 50 µL of NEBNext High Fidelity 2X PCR Master Mix (New England Biolabs), 0.5 µL of each primer at 100 µM ...
-
bioRxiv - Developmental Biology 2021Quote: ... The EnVT15159 PCR product was then digested using HindIII and AgeI high fidelity restriction enzymes (NEB) in Cutsmart buffer (NEB).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... All PCR reactions were carried out with Phusion High-Fidelity PCR Master Mix (New England Biolabs). The PCR products were mixed with an equal volume of 1× loading buffer (containing SYB green ...
-
bioRxiv - Biochemistry 2021Quote: All PCR amplification steps described here were performed using the Phusion High-Fidelity DNA Polymerase (NEB) according to the manufacturer’s protocols ...
-
bioRxiv - Genetics 2021Quote: ... The transposed DNA was converted into libraries using NEBNext High Fidelity 2x PCR Master Mix (NEB) and the Nextera Index Kit (Illumina ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR reactions were conducted using Q5® Hot Start High-Fidelity 2X Master Mix (NEB, M0494L). Ligations were conducted using isothermal assembly with NEBuilder® HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Gas1 were amplified by PCR using Q5 Hot Start High-Fidelity DNA Polymerase (NEB, M0493L) and cloned using CloneJET PCR Cloning Kit (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... Coding sequences were PCR amplified from cDNA or vectors with Q5 high-fidelity Taq Polymerase (NEB) using the following primers:
-
bioRxiv - Microbiology 2020Quote: 16S ribosomal DNA templates (∼1,465 bp) were amplified using Q5 high fidelity PCR (New England Biolabs) with the universal primer set 27F (5’-AGAGTTTGATCCTGGCTCAG-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were generated using the Q5 High-Fidelity DNA Polymerase (New England BioLabs, United Kingdom) with 50 ng genomic DNA as template ...
-
bioRxiv - Molecular Biology 2021Quote: ... Small RNA library cDNA was amplified and indexed using Phusion® High-Fidelity DNA polymerase (NEB). Constructs were purified in a 6% (w/v ...
-
bioRxiv - Molecular Biology 2020Quote: All fragments were generated with PCR using Q5 Hot Start High-Fidelity DNA Polymerase (NEB M0493) and gel purified using the QIAquick Gel Extraction Kit (Qiagen 28704 ...
-
bioRxiv - Genomics 2021Quote: ... We used the High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA, USA, Cat #M0492L) and the fragments’ optimal annealing temperatures (Supplementary Table 1) ...
-
bioRxiv - Genomics 2021Quote: ... and the purified DNA was amplified using NEBNext® High-Fidelity 2X PCR Master Mix (NEB) with 10 cycles of PCR ...
-
bioRxiv - Genomics 2021Quote: ... previously purified ATAC-DNA was amplified using NEBNext® High-Fidelity 2X PCR Master Mix (NEB) with 10 cycles of PCR ...
-
bioRxiv - Genomics 2021Quote: ... UpTag and DnTag barcodes were separately amplified with Phusion® High-Fidelity DNA polymerase (NEB, UK) using custom-designed primers at a concentration of 100 nM each in a total volume of 50 µL ...
-
bioRxiv - Immunology 2022Quote: ... Vκcons 5’GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC3’ and Jκ5SHM 5’AGCGAATTCAACTTAGGAGACAAAAGAGAGAAC3’ using Phusion High-Fidelity DNA Polymerase (New Englands Biolabs) and according to following program ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions targeting the 3CLpro gene were performed using Q5® High-Fidelity DNA Polymerase (NEB) and the resulting PCR products were mixed and matched to recombine SARSCoV-2 3CLproL50F ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was then amplified using NEBNext High Fidelity PCR Master Mix (M0541S, New England Biolabs Inc.) and barcoded primers (see table MMX) ...
-
bioRxiv - Biochemistry 2022Quote: ... Mutant constructs were created and amplified via PCR with Q5® High-Fidelity DNA Polymerase (NEB), and the respective primers provided by NEBaseChanger (Synbio Technologies ...
-
bioRxiv - Biochemistry 2022Quote: ... was designed as a template containing the full sequence and was amplified with two oligonucleotides (T7_Prom_Fwd and F30_Pepper_Rev) using Q5 High-fidelity DNA polymerase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Purified samples were combined with NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs M01541) for amplification ...
-
bioRxiv - Plant Biology 2023Quote: ... Amplifications were performed using the High-Fidelity Phusion PCR Master Mix (NEB, Frankfurt am Main, Germany) or the GoTaq G2 polymerase (Promega ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 20 μl was used for PCR amplification using Q5 hot start high-fidelity polymerase (NEB #M0494S) and a unique combination of the dual-barcoded primers P5 and P7 Nextera XT Index kit (Illumina #15055293) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Post-capture PCR was performed with the NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S) for 14-20 cycles ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used the 2X Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs), and 300 ng of the cDNA and 10 µM of each the RSV5U and RTRHC primers ...
-
bioRxiv - Microbiology 2022Quote: Putative replicon fragments were obtained through amplification PCR using high fidelity enzyme Q5 DNA polymerase (NEB) and primers including a KpnI or NcoI restriction site (Table 2) ...
-
bioRxiv - Microbiology 2022Quote: ... PCRs were performed using specific primers (Table S2C) and Q5 High- Fidelity Polymerase (NEB, Hitchin, UK) according to manufacturer’s instructions ...