Labshake search
Citations for New England Biolabs :
2001 - 2050 of 6017 citations for Type 1 Angiotensin II Receptor AGTR1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Stranded mRNA-Seq libraries were prepared from 250 ng of total RNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) implemented on the liquid handling robot Beckman i7 ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 ng of total RNA was used for library synthesis with the NEBNext Ultra II Directional RNA Library Preparation kit (New England Biolabs) according to the protocol of the manufacturer ...
-
bioRxiv - Genomics 2021Quote: The poly(A) RNA library was obtained using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) including the NEBNext Poly(A ...
-
bioRxiv - Genomics 2020Quote: ... and 150ng of each sample were fed to library preparation with NEBNext Ultra II DNA Library Preparation kit for Illumina (New England BioLabs) according to manufacturer’s instruction ...
-
bioRxiv - Genomics 2020Quote: ... we prepared libraries of circle-enriched and whole genomic control samples using NEBNext FS DNA Ultra II Library Prep Kit (New England Biolabs) using protocol modifications outlined in (Sproul and Maddison 2017) ...
-
bioRxiv - Developmental Biology 2022Quote: Libraries were generated using the NEBNext® Ultra™ II Directional RNA Library Prep kit for Illumina® (NEB #7760L) with 2.5 ng RNA input (1/300 adaptor dilution ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5ng of DNA was used for library preparation using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645S), SPRIselect beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2022Quote: ... The locus-specific HDR donors were generated by PCR amplification of the MACHETE bicistronic cassette using a high-fidelity DNA polymerase (Herculase II, Agilent or Q5, NEB). PCR fragments were column purified (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: RNA-seq libraries were prepared using the NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Samples were multiplexed using the NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was purified using standard Phenol:chloroform:isoamyl alcohol extraction and ethanol precipitation and used for library preparation with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) with 9 (H3K4me1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The Hi-C library for Illumina sequencing was prepared with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s instructions ...
-
Co-stimulatory molecules decide T cell fate through regulations of their invigoration and impairmentbioRxiv - Molecular Biology 2022Quote: ... mRNA sequencing libraries were prepared with 500 ng of total RNA of each sample using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) with NEBNext Poly(A ...
-
bioRxiv - Cancer Biology 2022Quote: ... genome-integrated sgRNA sequences were then amplified by PCR using Q5 Mastermix Next Ultra II (New England Biolabs, Cat# M5044L), with primers v2.1-F1-5’ GAGGGCCTATTTCCCATGATTC 3’ and v2.1-R1-5’ GTTGCGAAAAAGAACGTTCACGG 3’ ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was used to generate barcoded RNA-seq libraries using the NEBNext Ultra II Directional RNA Library preparation kit (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... NGS libraries were prepared from the purified mRNA using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs). Ten cycles of PCR amplification were applied to all libraries ...
-
bioRxiv - Cancer Biology 2022Quote: ... WES and RNA sequencing from the PDX samples was performed using NEBNext Ultra II FS DNA library Kit for Illumina (New England Biolabs), SureSelectXT HS Target Enrichment System for Illumina Paired-End Multiplexed Sequencing Library For Illumina Multiplexed Sequencing Platforms (Agilent) ...
-
bioRxiv - Developmental Biology 2022Quote: RNA-seq libraries were prepared using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, NEB) and NEBNext rRNA Depletion Kit (Human/Mouse/Rat ...
-
bioRxiv - Developmental Biology 2022Quote: RNA-seq libraries were prepared using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, NEB) and NEBNext rRNA Depletion Kit (Human/Mouse/Rat ...
-
bioRxiv - Cell Biology 2022Quote: Paired end libraries were constructed using the NEBNext Ultra II RNA Library Prep Kit (New England Biolabs, Ipswich, MA, USA) following the manufacturer’s protocol and sequenced on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Developmental Biology 2022Quote: ... Library preparation was performed using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB #E7645S), following the manufacturer’s instructions.
-
bioRxiv - Genomics 2022Quote: ... The “End-prep” was performed with 48 μl of sheared DNA in the reaction mixture using NEBNext Ultra II End Repair/dA-Tailing Module and NEBNext FFPE DNA Repair Mix (New England Biolabs (NEB), cat# E7546 ...
-
bioRxiv - Genetics 2022Quote: ... samples with the best fragmentation and high concentration were used for the creation of NGS libraries (NEBNEXT ULTRA II DNA Library Prep kit, NEB) and sequencing (Illumina Next seq 500 ...
-
bioRxiv - Immunology 2022Quote: ... followed by a NEBNext Ultra II Directional RNA library prep kit for Illumina (#E7760 and/or #E7770 with #E7765; NEB) with size selection by AMPure XP (#Ab3881 ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was isolated using Qiagen RNeasy Plant Mini Kit and cDNA was synthesised using ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs). SYBR Green Power Up (Thermofisher ...
-
bioRxiv - Physiology 2022Quote: ... and Poly-A mRNA-seq libraries from such samples were prepared using the Ultra II Directional RNA Library kit (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: A total of 1 ng of purified ChIP-ed DNA for each sample was used for library preparation using Ultra II DNA kit (NEB) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... at 37 °C for 15 min followed immediately by 10 cycles of indexed PCR using NEBNext Ultra II Q5 DNA Polymerase (New England Biolabs) and Illumina’s PE primer set ...
-
bioRxiv - Microbiology 2022Quote: ... The rRNA-depleted samples were used for stranded library preparation using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). The libraries were sequenced on a HiSeq2500 (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... Mutants were sequenced using Illumina Miseq and libraries were prepared using the DNA Ultra II library preparation kit (New England Biolabs). Mutations and depth were mapped using CLC-Bio Workbench v8 78.
-
bioRxiv - Microbiology 2022Quote: ... The fragment library was prepared using the NebNext Ultra II DNA Library preparation kit (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from IgG1 stimulated B cells 72 hour post-stimulation using TRIzol reagent (Fisher) and cDNA was prepared using the Protoscript II kit (NEB). Germline transcription was analyzed using quantitative PCR with SYBR Green (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... Two reactions of 2-4 µg DNA each were adaptor-ligated and indexed using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) and NEBNext Multiplex Oligos for Illumina (New England Biolabs) ...
-
bioRxiv - Systems Biology 2022Quote: Library preparation was performed with NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext Ultra II Directional RNA Library Prep Kit (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Libraries of ovule samples were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) using NEBNext® Multiplex Oligos for Illumina (Index Primers Set 1 and Index Primers Set 2 ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized from total RNA and used for library construction with the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: RNA libraries were prepared using NEBNext Poly(A) mRNA Magnetic Isolation Module and the NEBNext Ultra II Directional RNA Library Prep Kit (NEB), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... were constructed using the NEBNext Ultra II DNA library preparation kit for Illumina according to the manufacturer’s instructions (NEB E7645S). To determine the number of PCR cycles required for amplification ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ribosomal-depleted RNA was then used for library preparation using NEBNext Ultra II Directional RNA Library Prep kit (NEW ENGLAND BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and libraries for deep sequencing were prepared using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs). Quality of DNA libraries was validated using a 2100 Bioanalyzer Instrument (Agilent) ...
-
bioRxiv - Plant Biology 2023Quote: ... and the purified mRNA was used to construct libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) following manufacturer instructions ...
-
bioRxiv - Genomics 2022Quote: ... We converted the DNA into an Illumina sequencing library using the NEB Ultra II library preparation kit (NEB, Ipswich, MA) with a Y-adaptor ...
-
bioRxiv - Genomics 2022Quote: ... The ploidy of the GM12878 and Detroit 532 were confirmed via NGS as follows: sequencing libraries were generated using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs), and libraries were sequenced on a MiSeq (Illumina ...
-
bioRxiv - Genetics 2022Quote: Libraries for RNA-seq analysis were prepared using 500 ng of total RNA from three independent replicates using NEBNext Ultra II Directional RNA library prep kit for Illumina (NEB) and PolyA mRNA magnetic isolation module (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... and taken forward for library preparation using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs). A total of 4 libraries were generated ...
-
bioRxiv - Genomics 2022Quote: ... and 100 ng of each PCR product was used to generate the final libraries using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs). The libraries were indexed for multiplexing using NEBNext multiplex oligos kit for Illumina (New England Biolabs) ...
-
bioRxiv - Neuroscience 2022Quote: ... 250 ng of the purified PCR product was processed with the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) according to manufacturer protocols ...
-
bioRxiv - Neuroscience 2022Quote: ... Harvested RNA was prepared for sequencing with the NEBNext® Ultra™ II RNA Library Prep Kit for Illumina (NEB). Two biological replicates were performed for each condition ...
-
bioRxiv - Neuroscience 2022Quote: ... Strand-specific RNA libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina with NEBNEXT poly(A) mRNA Isolation Module (New England Biolabs) according to manufacturer recommendations ...
-
bioRxiv - Neuroscience 2022Quote: ... Library preparation was performed using NEBNext® Ultra II Directional RNA Library Prep Kits for Illumina (New England Biolabs, USA), according to the manufacturer’s protocol with 8 PCR cycles ...
-
bioRxiv - Molecular Biology 2022Quote: ... Preparation of the sequencing libraries was performed using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). 150-bp paired-end sequencing was carried out using Illumina Novaseq 6000 ...