Labshake search
Citations for New England Biolabs :
2151 - 2200 of 6017 citations for Type 1 Angiotensin II Receptor AGTR1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ChIP-seq libraries were constructed from 100 ng of DNA samples using the NEB Ultra II DNA Library Prep Kit for Illumina (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and sequencing libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep with Sample Purification Beads (NEB E7765S). RNA-seq libraries for each sample type were prepared ...
-
bioRxiv - Systems Biology 2023Quote: ... Each library was dissolved in 100µL Tris 10mM pH 8 and amplified by PCR with specific primers (Fw: GTGAACCGTCAGATCGCCTCGGCACTCCAGTCCT, Rv: AGAGGGTTAGGGATAGGCTTACCTCAGGCTAGTGCGGACCGAGTCG) using NEBNext Ultra II Q5 HotStart (NEB). PCR cycling parameters were set as follows ...
-
bioRxiv - Zoology 2023Quote: ... followed by the production of stranded cDNA libraries with NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Individual barcodes were applied with NEBNext dual adaptors (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: ... Around 5 ng of purified CUT&RUN-enriched DNA was used to prepare NGS libraries using the NEBNext Ultra II DNA Library Prep Kit (NEB) with NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1 ...
-
Emergence of RNA-guided transcription factors via domestication of transposon-encoded TnpB nucleasesbioRxiv - Genetics 2023Quote: ChIP-seq Illumina libraries were prepared for immunoprecipitated and input samples using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). Following adapter ligation ...
-
bioRxiv - Microbiology 2023Quote: ... The mRNA was converted to cDNA using the Invitrogen PhotoScript II First-Strand Synthesis System (New England Biolabs, Ipswich, MA) according to the manufacturer’s instructions.
-
bioRxiv - Systems Biology 2023Quote: ... the sequencing library was generated with the NEBNext® Ultra™II Directional RNA Library Prep Kit (New England Biolabs) and paired-end sequencing was processed with the NovaSeq 6000 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR amplification of transposon-genome junctions was performed using the cycling parameters described in the kit for 11 cycles with Q5 Ultra II FS Master Mix (NEB) using primers YL006 (AGCGGCAATTTCACACAGGA ...
-
bioRxiv - Bioengineering 2023Quote: ... The sequencing library was generated using NEBNext® UltraTM II DNA Library Prep Kit (New England Biolabs, MA, United States) and sequenced on an Illumina Nova6000 platform generating 250-bp paired-end reads (Guangdong Magigene Biotechnology Co. ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was extracted from 5-10 µl of the cell scrape and prepared for sequencing using the NEBNext Ultra II FS DNA Library Prep Kit (NEB) with the following modifications ...
-
bioRxiv - Cell Biology 2023Quote: ... Amplified DNA was then size enriched using 0.9X volume SPRI beads and subject to another round of PCR using 10x cycles with NEBNext Ultra II (NEB M0544S) using primers pairs cTF383+cTF399 for the promoter and oSA021+oSA023 for the gene body to add Illumina Read1 and Read2 overhangs ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA sequencing libraries were prepared with the NEBNext Ultra II DNA library prep kit according to the manufacturer’s instructions (New England Biolabs, E7645S) and sequenced on the Illumina NextSeq platform with the 75-cycle paired end kit (NextSeq 500/550 High Output Kit).
-
bioRxiv - Microbiology 2023Quote: ... 3 to 5 ng of RNA from input and corresponding m6A-IPs were used for NGS library production following the protocol NEBNext Ultra II directional RNA library prep kit for Illumina (New England Biolabs), treating samples as rRNA-depleted and fragmented RNAs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... A total of 500 ng of genomic DNA was fragmented using NEBNext Ultra II FS DNA Fragmentation module (New England Biolabs) for 20 min and 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ChIP-seq libraries were prepared with 2 ng of input or IP DNA using the NEBNext Ultra II DNA Library kit for Illumina (New England Biolabs). The quality of the libraries was assessed using the High Sensitivity DNA kit (Agilent ...
-
bioRxiv - Pathology 2023Quote: ... cDNA libraries for sorted KCs were generated using Next Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). RNA-Seq libraries were sequenced on an Illumina NovaSeq 6000 (40 million reads per sample) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Six multiplex amplicons were ligated to Illumina TruSeq adapters using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB), pooled ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500ng of total RNA was used for reverse transcription using ProtoScript II First Strand cDNA Synthesis Kit (New England BioLabs). For quantification ...
-
bioRxiv - Molecular Biology 2023Quote: ... was used as input for PolyA+ directional RNA-seq library preparation using the NEBNext Ultra II Directional RNA-seq Kit (#E7765, NEB) with the PolyA mRNA magnetic isolation module (#E7490 ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries for RNA-Seq were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) and sequenced on the NextSeq500 (Illumina ...
-
bioRxiv - Genetics 2023Quote: ... The presence of infectious rIBV in the allantoic fluid was confirmed by a two-step reverse transcription polymerase chain reaction (RT-PCR) protocol using Protoscript II reverse transcriptase (NEB) and the random primer 5′-GTTTCCCAGTCACGATCNNNNNNNNNNNNNNN-3′ for the RT step and recombinant Taq polymerase (Invitrogen ...
-
bioRxiv - Genetics 2023Quote: ... The library preparation was done using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). The libraries were sequenced on the NextSeq500 instrument (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... Ribosomal RNA was depleted using the Illumina Ribo-Zero Plus rRNA Depletion kit followed by library preparation with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Purified DNA was then constructed into libraries suitable for Illumina sequencing using the NEXT Ultra II library preparation kit (NEB). ChIP libraries were sequenced on the Illumina Hiseq 2500 or Nextseq 550 at the Tufts University Genomics facility.
-
bioRxiv - Microbiology 2023Quote: ... 5’ phosphorylation and dA-tailing by NEBNext FFPE DNA Repair and NEBNext Ultra II End prep modules (New England Biolabs) and purified with AMPure XP (Beckman Coulter ...
-
bioRxiv - Microbiology 2023Quote: ... RNA sequencing libraries were prepared using the NEBNext® Ultra™ II Directional RNA Library Prep Kit (New England Biolabs) and the DNA library was prepared using the NEBNext® Microbiome DNA Enrichment Kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... The fragmented DNA was first repaired using the NEBNext FFPE DNA Repair Mix and NEBNext Ultra II End Repair/dA-Tailing Module (New England BioLabs). Subsequently ...
-
bioRxiv - Genomics 2023Quote: ... mRNA was eluted from the oligo-dT beads and fragmented by incubating with the First Strand Synthesis Reaction buffer and Random Primer Mix (2×) from the NEBNext Ultra II Directional Library Prep Kit for Illumina (#NEBE7760; New England Biolabs) for 15Lmin at 94°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The genomic DNA region containing the integrated sgRNA was amplified by PCR using Q5 Mastermix Next Ultra II (New England Biolabs) with the LCV2_forward and LCV2_reverse primers (Table S3) ...
-
bioRxiv - Molecular Biology 2023Quote: Sequencing libraries of DNA fragments isolated following CUT&RUN were prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs) and the NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5′ phosphorylated and 3’ A-tailed by NEBNext Ultra II End Prep Enzyme Mix following the manufacturer’s instruction (New England Biolabs #E7645L). An adaptor was ligated ...
-
Regulation of transcription patterns, poly-ADP-ribose, and RNA-DNA hybrids by the ATM protein kinasebioRxiv - Molecular Biology 2023Quote: ... as well as input samples were used to make sequencing libraries using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) with NEBNext Multiplex dual index primers using 12 amplification cycles and 2 additional AMPure XP clean-up steps at 0.8X ...
-
bioRxiv - Molecular Biology 2023Quote: ... Micro-C libraries were then prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) as described74 and sequenced using an Illumina NovaSeq 6000.
-
bioRxiv - Evolutionary Biology 2023Quote: ... RNAseq libraries were prepared using a NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs E7760S) with NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Cancer Biology 2023Quote: ... NGS libraries were prepared from 30ng of the PCR product using the NEBnext Ultra II DNA library preparation kit for Illumina (New England Biolabs) according to manufacturer’s recommendations and using NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Cancer Biology 2023Quote: ... It mainly consisted of whole genome library preparation from 100ng of gDNA following NEBNext Ultra II FS (New England Biolabs) recommendations ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 ng of DNA for each sample was then used with the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) and completed according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 300 ng of genomic DNA and used the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) to prepare the libraries ...
-
bioRxiv - Genetics 2023Quote: ... Dual-indexed sequencing libraries were made using the NEBNext Ultra II DNA Library Prep Kit for Illumina (E7645S, New England Biolabs) or CUTANA™ CUT&RUN Library Prep Kit with Primer Set 1 (14-1001 ...
-
bioRxiv - Cell Biology 2023Quote: ... was fragmented using a Covaris E220 sonicator and used for metagenomic library preparation using the NEBNext Ultra II DNA Library Prep kit for Illumina (New England BioLabs), with the target insert length of 350 bp ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA-seq libraries were prepared with NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, E7765) and their quality was assessed on Bioanalyzer using High Sensitivity DNA assay (Agilent) ...
-
bioRxiv - Biochemistry 2023Quote: ... was used in sequential reverse transcription and PCR amplification steps using the Protoscript II first strand cDNA synthesis kit and Q5 Hi-fidelity DNA polymerase (NEB) according to manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequence ready polyA-enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina (NEB, E7760), according to manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... the fragmented nucleic acids were end-repaired and A-tailed using the NEBNext Ultra II End Repair and A-Tailing Module (New England Biolabs). The samples were cleaned with Totalpure NGS mag-bind (Omega-BioTek ...
-
bioRxiv - Microbiology 2023Quote: ... ∼200 fmol of purified amplification products were subjected to DNA repair and end-prep using a NEBNext DNA repair mix and NEBNext Ultra II End Repair/dA-Tailing Module (New England Biolabs). The library preparation included two ligation steps ...
-
bioRxiv - Microbiology 2023Quote: ... PolyA+ RNA was purified from ∼100 ng of total RNA and sequencing libraries were prepared with the NEBNext Ultra II RNA library kit (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RNA-seq libraries were prepared using a NEB-Next Ultra II Directional Library Prep Kit for Illumina (E7760, NEB). Library sizes were determined on a Bioanalyzer ...
-
bioRxiv - Microbiology 2023Quote: ... The DNA from different barcoded samples was pooled and the adapter AMII (ONT) was ligated using the NEBNext Ultra II Ligation Module (NEB). Sequencing was done with a R10.4 MinION Flow Cell using a MinION Mk1B (ONT).
-
bioRxiv - Genomics 2023Quote: ... Library preparation was performed using the NEBNext Ultra II Directional RNA Library Prep Kit (New England BioLabs Inc. MA, USA) for strand-specific Illumina libraries ...