Labshake search
Citations for New England Biolabs :
1851 - 1900 of 6017 citations for Type 1 Angiotensin II Receptor AGTR1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Purified ChIP DNA was used to prepare Illumina multiplexed sequencing libraries using the NEBNext Ultra II DNA Library Prep kit and the NEBNext Multiplex Oligos for Illumina (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... The fragments were end-repaired and ligated with Illumina compatible adaptors using the NEBNext UltraTM II DNA Library Prep Kit (NEB). The adaptor-ligated DNA was hybridized to custom Agilent biotinylated oligonucleotide probes across a 700bp region (53032 probes ...
-
bioRxiv - Pathology 2021Quote: ... and the NEBNext® Ultra™ II Non-Directional RNA Second Strand Synthesis Module (New England Biolabs, Ipswich, MA, USA). After conversion into cDNA ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA synthesis was performed for 60 min at 42 °C and 5 min at 80 °C using ProtoScript II First Strand cDNA synthesis kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Library construction was performed with 20ng of input total RNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina - polyA mRNA workflow (New England Biolabs). The libraries were sequenced with a NextSeq 500 High Output 75 cycle kit (Illumina) ...
-
bioRxiv - Cancer Biology 2022Quote: Sequencing libraries were prepared using the NEBNext Ultra II Directional Kit with polyA selection module (New England Biolabs, MA, USA). In brief ...
-
bioRxiv - Molecular Biology 2022Quote: 1 μg of total RNA was used to synthesize cDNA with dTALE gene specific primer dTALE-GSP_R0 (cgacttgagcagcaggagatgc) using the ProtoScript®II first strand cDNA synthesis kit (New England Biolabs) according to the manufacturer’s manual ...
-
bioRxiv - Cancer Biology 2022Quote: ... mRNA enrichment and library preparation was performed using the NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext Ultra II RNA Library Prep kit (NEB). Sequencing was done using the Illumina NextSeq500 to obtain >20 million 75bp single-end or 37bp paired-end reads per sample or at Genewiz (HiSeq ...
-
bioRxiv - Microbiology 2022Quote: ... 1μg of input RNA was used for RNA library preparation using the NEB Next Ultra II RNA Library Prep kit for Illumina (E7775L; NEB). Prepared libraries were quantified using real time PCR and bioanalyzer ...
-
bioRxiv - Genetics 2022Quote: ... We prepared the libraries with the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs, Ipswich, Massachusetts, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: ... Libraries were amplified using NEBNext Ultra II Q5 polymerase and unique combinations of primers from the NEBNext Multiplex Oligos for Illumina (NEB). The following amplification protocol was used ...
-
bioRxiv - Genetics 2022Quote: ... All samples were processed in a single batch and the isolated mRNA from each sample was used to prepare RNA sequencing libraries using the NEBNext Ultra II Directional RNA Library Prep kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: Illumina libraries were constructed from 100 ng of amplified cDNA libraries using the NEBNext Ultra II FS library prep kit for Illumina (New England Biolabs) with some modifications ...
-
bioRxiv - Molecular Biology 2022Quote: ... A volume of cDNA corresponding to 2.5 ng of the input RNA was subjected to 35 cycles of PCR with the 2 x NEBNext Ultra II Q5 Master Mix (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... and mixed with a master mix consisting of 20 μl of 2 x NEBNext Ultra II Q5 Master Mix (NEB), 1 μl of 40 μM P5* primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a volume of cDNA corresponding to 5 ng of the input RNA was subjected to 30 cycles of PCR with the 2 x NEBNext Ultra II Q5 Master Mix (NEB).
-
bioRxiv - Synthetic Biology 2022Quote: ... Extracted gDNA was prepared for sequencing using a modified protocol63 for the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) at ½ of the recommended reaction volume ...
-
bioRxiv - Physiology 2022Quote: ... Stranded cDNA libraries were created with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). The 30 fish were sequenced for 100 base pair reads on one lane of a NovaSeq 6000 (Illumina) ...
-
bioRxiv - Neuroscience 2022Quote: ... DNA templates were generated for each sgRNA by annealing oligonucleotides using the NEBNext Ultra II Q5 master mix (NEB, M0544L). The HiScribe Quick T7 kit (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... Reverse transcription of 50 ng total RNA was performed using Protoscript II First Strand cDNA Synthesis Kit with oligo(dT)23 primers (NEB). cDNA was undiluted ...
-
bioRxiv - Developmental Biology 2022Quote: ... IGM generated sequencing libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760, New England Biolabs). A polyA enrichment step (E7490 ...
-
bioRxiv - Microbiology 2022Quote: ... Libraries were prepared for metatranscriptomic sequencing using the NEB-Next Ultra II RNA Library Prep Kit for Illumina (New England Biolabs) with the addition of an rRNA depletion step (NEBNext rRNA Depletion Kit (Human/Mouse/Rat) ...
-
bioRxiv - Genetics 2022Quote: ... total RNA was reverse transcribed using a primer specific for library mRNA (TE121) and the Protoscript II reverse transcriptase (NEB). Following reverse transcription ...
-
bioRxiv - Genomics 2022Quote: DNA sequencing libraries were prepared using a protocol designed for library preparation of Laser Capture Microdissected Biopsy (LCMB) samples using the Ultra II FS enzyme (New England Biolabs) for DNA fragmentation as previously described [68] ...
-
bioRxiv - Genomics 2022Quote: ... The remaining steps of library preparation were done using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs). Adapters and PCR primers from New England BioLabs were employed ...
-
bioRxiv - Microbiology 2022Quote: ... 5 ng of total RNA was used for intact RNA library preparation (NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760, New England BioLabs). To obtain sufficient RNA for the analysis of oral samples ...
-
bioRxiv - Microbiology 2022Quote: RNA library was assembled using NEBNext Poly(A) mRNA Magnetic Isolation Module (E7490) and NEBNext Ultra II RNA Library Prep Kit for Illumina (E7770, New England Biolabs) as per manufacturer instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were prepared from the cDNA using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs). Libraries were sequenced with the Illumina HiSeq 2500 or 4000 systems to produce 100bp paired-end reads ...
-
bioRxiv - Microbiology 2022Quote: ... the following reagents were added to achieve the specified amounts or concentrations in 10 µL reactions: 100 U ProtoScript II reverse transcriptase (NEB), 10 U RNase inhibitor (murine ...
-
bioRxiv - Microbiology 2022Quote: ... The extracted RNA was then reverse transcribed to cDNA using ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs). Subsequently ...
-
bioRxiv - Immunology 2022Quote: ... Subsequently the libraries were prepared with the NEBNext® Ultra II DNA Library Prep Kit for Illumina® (NEB, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2022Quote: ... The final double strand DNA fragments pool was ligated with adapters and amplified with Illumina index primers by using NEBNext Ultra II NGS library prep kit (NEB). The prepared NGS library was sequenced as 150×150 bp pair-end sequencing in the Miseq or Hiseq 2500.
-
bioRxiv - Biochemistry 2022Quote: ... sequencing libraries were prepared with a NEBNext Ultra II Directional RNA Library Prep Kit (7765L, New England Biolabs, Ipswich, MA), and samples were sequenced on an Illumina NextSeq 500 platform in 76bp single-end reads ...
-
bioRxiv - Cell Biology 2022Quote: ... Poly-A(+) RNA sequencing libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs). Two µg of RNA per sample were processed in two separate reactions (separate technical replicas ...
-
bioRxiv - Microbiology 2022Quote: ... RNA-seq libraries were prepared from mRNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) as by manufacturer instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Isolated mRNA was used to generate dual-indexed cDNA libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Eight cycles of PCR amplification were applied to all the libraries ...
-
bioRxiv - Immunology 2022Quote: Fragmentasion and adaptor ligation were performed using 10-20ng of second-PCR product as a template with NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs) with some modifications ...
-
bioRxiv - Developmental Biology 2022Quote: ... Library preparation was performed using the NEBNext Ultra II DNA Library Prep Kit (E7805S, New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 400 ng to 1 μg of input RNA was used as a template for reverse transcription using Protoscript II First Strand cDNA Synthesis Kit (NEB) and random hexamers ...
-
bioRxiv - Cell Biology 2022Quote: ... 60 ng of total RNA was used for library preparation using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina with NEBNext rRNA Depletion Kit (New England Biolabs). The libraries were paired-end sequenced (2 × 75 bp ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μg of total RNA was used as an input material for library preparation using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina with NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). The libraries were multiplexed and paired-end sequenced (2 × 75 bp ...
-
bioRxiv - Immunology 2020Quote: ... all DNA precipitated from pA-MN digestion was used for library preparation using NEBNext Ultra II DNA Library Prep Kit (NEB). The adaptor was diluted to 1:25 for adaptor ligation ...
-
bioRxiv - Microbiology 2021Quote: ... Amplification-free indexed Illumina libraries were prepared (9) using the NEBNext Ultra II DNA Library Prep kit (New England BioLabs). The libraries were quantified using the Accuclear Ultra High Sensitivity dsDNA Quantitative kit (Biotium ...
-
Adaptive translational pausing is a hallmark of the cellular response to severe environmental stressbioRxiv - Molecular Biology 2020Quote: ... rRNA-depleted cDNA was used in the PCR using NEBNext® Ultra™ II Q5® Master Mix (NEB, M0544S) and NEBNext® Multiplex Oligos for Illumina® (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA libraries were generated using 1µg RNA with the magnetic mRNA isolation module and NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs). DNA library was amplified by 7 PCR cycles and quality was analyzed using the fragment analyzer (Advanced Analytical) ...
-
bioRxiv - Neuroscience 2020Quote: Illumina compatible libraries were produced from 1250ng total RNA using NEBNext Ultra II RNA Library Prep Kit (NEB Cat#E7770S) following manufactures protocol with the following modifications ...
-
bioRxiv - Microbiology 2021Quote: ... The double stranded fragments were end prepped with NEBNext Ultra II End Repair/dA-Tailing Module (New England Biolabs, USA) and were barcoded with EXP-NBD196 (Oxford Nanopore Technologies ...
-
bioRxiv - Genomics 2020Quote: ... We added Illumina TruSeq adaptors using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs: E7645) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Full-length TPX2 with N-terminal Strep II-6xHis-GFP-TEV site tags was cloned into pST50Tr-STRHISNDHFR (pST50) vector61 using Gibson Assembly (New England Biolabs). N-terminal 6xHis-tagged ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were then directly subjected to the workflow for strand-specific RNA-Seq library preparation (Ultra II Directional RNA Library Prep, NEB). For ligation custom adaptors were used (Adaptor-Oligo 1 ...