Labshake search
Citations for New England Biolabs :
151 - 200 of 1832 citations for 26S Proteasome Non ATPase Regulatory Subunit 10 PSMD10 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: cDNA synthesis was done using NEBNext® non-directional RNA-Seq workflow and NEBNext Ultra RNA First Strand Synthesis Module (NEB #E7771) and NEBNext® RNA Second Strand Synthesis Module (NEB #E6111) ...
-
bioRxiv - Developmental Biology 2022Quote: One microgram of total RNA from each sample was subjected to cDNA library construction using a NEBNext® Ultra non-directional RNA Library Prep Kit for Illumina® (New England Biolabs). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... we performed second strand synthesis using the NEBNext Ultra II Non-Directional RNA second strand synthesis module as per the suggested protocol (NEB, Catalog# E6111L). The synthesized DNA was purified via 1X Mag-Bind TotalPure NGS beads and eluted in ~12 ul of sterile water ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA sequencing libraries were prepared from 100 ng of input RNA using the non-directional kit NEBNext Ultra™ II RNA Library Prep Kit for Illumina (NEB, #E7775) with the NEBNext Poly(A ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA/sgRNA/Cas9 ratios of 1/10/10 were used in a 10 µl reaction using the buffer supplied (NEB) and DEPC-treated water (Haussmann et al ...
-
bioRxiv - Genomics 2019Quote: ... DNA was digested by adding 10 µL NlaIII (10 U/µL, NEB) and incubated for 3½ h at 37 °C with shaking at 1200 rpm ...
-
bioRxiv - Cancer Biology 2020Quote: ... The ligation reaction (10 μL) consisted of 10 units of BbsI (NEB), 600 units of T4 DNA ligase (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units Esp3I (NEB), 800 units T4 DNA ligase (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units Esp3I (NEB), 800 units T4 DNA ligase (NEB ...
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnII (NEB), 1X DpnII buffer (NEB) ...
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnI (NEB), 1X CutSmart (NEB) ...
-
bioRxiv - Microbiology 2019Quote: ... coli 10-Beta (NEB) and BL21(DE3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 10 mM dNTPs (NEB), 10 μM Fwd (5’ GAGGGCCTATTTCCCATGATTC) ...
-
bioRxiv - Biochemistry 2020Quote: ... Reverse transcription reactions were then used as input for the NEBNext® Ultra II Non-Directional RNA Second Strand Synthesis Module (New England Biolabs, cat. E6111L). Second strand synthesis was performed by incubating 1 h at 16°C ...
-
bioRxiv - Genetics 2020Quote: ... Reverse transcription reactions were then used as input for the NEBNext® Ultra II Non-Directional RNA Second Strand Synthesis Module (New England Biolabs, cat. E6111L). Second strand synthesis was performed by incubating 1 h at 16°C ...
-
bioRxiv - Immunology 2021Quote: ... DNA oligomers with Golden Gate overhangs were annealed and subsequently cloned into the non-digested target plasmid using the NEB® Golden Gate Assembly Kit (BsmBI-v2, New England Biolabs cat E1602L). sgRNAs have been cloned into pXPR_502 (addgene 96923 ...
-
bioRxiv - Genomics 2023Quote: ... The resulting DNA fragments were then either methylated using non-specific adenine EcoGII methyltransferase (New England Biolabs, high concentration stock 2.5e4 U/mL) or left unmethylated ...
-
bioRxiv - Microbiology 2023Quote: ... followed by the second DNA chain synthesis using NEBNext Ultra II Non-Directional RNA Second Strand Synthesis Module (New England Biolabs, Ipswich, MA, USA). The obtained cDNA was used to prepare a NEBNext DNA Library Prep Set for Ion Torrent (New England Biolabs ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, N0446), 10 μL 10x T4 DNA Ligase Reaction Buffer (NEB B0202S) ...
-
bioRxiv - Genetics 2020Quote: ... We digested 10 µg of RCP83 using 10 µL SfiI enzyme (NEB, #R0123S) in 50 µL 10x NEB CutSmart buffer and water to 500 µL ...
-
bioRxiv - Cell Biology 2022Quote: ... with 10 mM 10x Adenosine 5’-Triphosphate (1:10, #P0756S, New England Biolabs). The reaction was incubated in a thermocycler for 37 °C for 30 min ...
-
bioRxiv - Systems Biology 2019Quote: ... To the RNA was then added 10 μl of 10× Capping Buffer (NEB), 5 μl of 10 mM GTP ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, #N0446), 10 μl 10x T4 DNA Ligase Reaction Buffer (NEB #B0202S) ...
-
bioRxiv - Cell Biology 2021Quote: ... To 10 ul of this sample 10 μl of lambda phosphatase buffer (NEB), 10 μl of 10 mM MnCl2 ...
-
bioRxiv - Genomics 2020Quote: DpnI digest: 10 ug genomic DNA + 10 uL CutSmart Buffer (New England Biolabs) + 2 uL DpnI (New England Biolabs ...
-
bioRxiv - Cancer Biology 2022Quote: ... antibody and anti-Gluc antibody (New England Biolabs, ref. E8023).
-
bioRxiv - Developmental Biology 2023Quote: ... a MBP antibody (Anti-MBP Monoclonal Antibody, HRP conjugated, NEB), a GST antibody (GST Tag Monoclonal Antibody ...
-
bioRxiv - Molecular Biology 2021Quote: ... in a 10 μl reaction using 10 U T4 RNA ligase (New England Biolabs) in 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Genomics 2023Quote: ... 25 µl of 10×CutSmart Buffer and 10 µl of Hae III (NEB, #R0108L) were added to each tube ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 μL RNAs were mixed thoroughly with 1 μL T4 PNK (10 U, NEB), 1 μL purified TS2126 and 1 μL PAP1 enzyme (NEB ...
-
bioRxiv - Genomics 2020Quote: Dialyzed chromatin was utilized as input (1.5 ug) for methylation reactions with the non-specific adenine EcoGII methyltransferase (New England Biolabs, high concentration stock 2.5e4U/mL). Reactions were performed in a 200uL reaction with 1X CutSmart Buffer and 1mM S-adenosyl-methionine (SAM ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Site directed mutagenesis was then performed for the promoter region of iLight repressor through using NEB Q5® Site-Directed Mutagenesis Kit with non-overlapping primers or NEBuilder® HiFi DNA Assembly (New England BioLabs, MA, USA) with overlapping primers ...
-
bioRxiv - Cell Biology 2020Quote: ... coli (10-beta, NEB, C3020K) were thawed on ice and mixed with 6 µg of purified 3Cs-DNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 U of HaeIII (NEB), and >0.1 pg of genomic template DNA ...
-
bioRxiv - Synthetic Biology 2019Quote: ... coli NEB 10-beta (NEB) was used for cloning ...
-
bioRxiv - Genomics 2021Quote: ... 10 μL buffer 3.1 (NEB) and ultrapure water to a final volume of 70 μL ...
-
bioRxiv - Genetics 2021Quote: ... 10 μl DpnII (R0543M, NEB) (500 U per tube ...
-
bioRxiv - Bioengineering 2020Quote: ... 10 units BsaI (NEB #R3733), 10 units PNK (Thermo Fisher) ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units BsaI-HFv2 (NEB), 100 units T4 DNA ligase (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 10 μl MboI (NEB R0147S), 5 μl CviQI (NEB R0639S) ...
-
bioRxiv - Microbiology 2022Quote: ... 10 mm NTP mix (NEB), Ribolock (Thermo scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli cells (NEB 10-beta). The recombinant N-terminal His6-tagged TrxA protein encoded by slr0623 was expressed and purified as previously described previously for His-tagged proteins (Lapina et al ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10 U BsaI-HFv2 (NEB) for assembly into levels 1 and 3 or 10 U BpiI (Thermo Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... 10 µg λ DNA (NEB) was added to a 50 µL reaction with 80 µM biotin-dCTP (Invitrogen) ...
-
bioRxiv - Plant Biology 2019Quote: ... 10 μl PNK enzymes (NEB) and 15 μl of 10mM ATP and incubated at 37°C for 10 mins on a Thermomixture (1400 rpm) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli 10-beta (NEB C3020) cells ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 10 U MseI (NEB, R0525S), 1x ddPCR supermix for probes and 50-300 ng of genomic DNA (gDNA) ...
-
bioRxiv - Biochemistry 2021Quote: ... E.coli (NEB® 10-beta) containing both a Cas effector and gRNA plasmid (Table S3 ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 U T5 exonuclease (NEB) were added ...
-
bioRxiv - Cell Biology 2020Quote: ... with 10 mM VRC (NEB) per coverslip for 10 minutes at room temperature ...