Labshake search
Citations for New England Biolabs :
1 - 50 of 1832 citations for 26S Proteasome Non ATPase Regulatory Subunit 10 PSMD10 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... the 4.6kb regulatory region of MpKNOX1 was seamlessly cloned (NEBuilder, NEB) into the HindIII/XbaI site 5’ of the Gateway cassette of pMpGWB401 (Addgene enry #68666) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Candidate cis-regulatory regions were amplified by PCR with OneTaq polymerase (NEB) and cloned into the pCR8 plasmid (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: Regulatory elements were amplified from mouse genomic DNA with Q5 polymerase (NEB, M0491) using primers listed in Table S8 and cloned into pGL4.24[luc2P/minP] (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... and the targeted small regulatory RNAs were amplified using Phusion polymerase (New England BioLabs) with primers containing 20bp of homology to the pMQ123 BamHI cut-site at their 5’ end ...
-
bioRxiv - Molecular Biology 2019Quote: ... for the presence of all core TFIIH subunits and appropriate fractions were pulled and mixed with 10 ml of amylose resin (New England BioLabs) pre-equilibrated in washing buffer (400 mM KCl ...
-
bioRxiv - Developmental Biology 2022Quote: ... The bicistronic reporters used to detect regulatory elements within 3′ UTRs were constructed by Gibson Assembly (NEB) and standard methods ...
-
bioRxiv - Bioengineering 2024Quote: ... input genomic DNA was amplified in a 10-μl reaction for 26 cycles using NEBNext High-Fidelity 2x PCR Master Mix (NEB). PCR products were purified using Sera-Mag magnetic beads (Cytiva ...
-
bioRxiv - Plant Biology 2020Quote: ... MBP-PUB25/26 were purified using Amylose Resin (NEB) by batch purification according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: The DMRT regulatory region was amplified from the DMRT>GFP plasmid [28] using Phusion polymerase (New England Biolabs) with primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... Mutations into the Snail binding motif of the Crbn regulatory sequences were obtained by recombination using NEBuilder (NEB England) of PCR amplified fragments of the Crbn reporter constructs (primers in Supp Table 6) ...
-
bioRxiv - Neuroscience 2020Quote: ... a catalytic subunit of protein kinase A (PKA Cα, New England Biolabs); Ca2+/calmodulin-dependent protein kinase II (CaMKII ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or 279bp (high cost) of regulatory region (Fig. S1) and cloned into pKD3 upstream of the chloramphenicol resistance cassette using Gibson Assembly (NEB). Primers to amplify hilD contained ∼40bp homology to the sites flanking a NdeI site in pKD3 ...
-
bioRxiv - Developmental Biology 2024Quote: Reporter gene fusions for cis-regulatory analysis were made using either PCR fusion or Gibson Assembly Cloning Kit (NEB #5510S) 88 ...
-
bioRxiv - Biochemistry 2021Quote: ... An XK 26/60 column was packed with chitin resin (NEB), and equilibrated with lysis buffer ...
-
bioRxiv - Developmental Biology 2022Quote: Reporter gene fusions for cis-regulatory analysis of terminal identity genes were made using either PCR fusion (Hobert, 2002) or Gibson Assembly Cloning Kit (NEB #5510S). Targeted DNA fragments were fused (ligated ...
-
bioRxiv - Developmental Biology 2019Quote: Reporter gene fusions for cis-regulatory analysis of terminal identity genes were made using either PCR fusion [68] or Gibson Assembly Cloning Kit (NEB #5510S). Targeted DNA fragments were fused (ligated ...
-
bioRxiv - Genetics 2022Quote: ... Strains expressing exogenous Dbp1 from the LEU2 locus were created by cloning the DBP1 ORF as well as ∼1kb of upstream and downstream regulatory sequence into a single integration plasmid targeted to LEU2 This plasmid was linearized by digestion with SwaI nuclease (NEB, Ipswich, MA) and transformed into the dbp1Δ::KANMX6 strain.
-
bioRxiv - Synthetic Biology 2019Quote: ... The three backbone fragments were combined together with the synthesized CggR cis-regulatory element using the NEB Gibson assembly kit (New England Biolabs, MA, US) according to the manufacturer instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... pre-existing SNAP-tagged histones were first quenched by incubating cells with 10 μM of the non-fluorescent SNAP reagent (SNAPcell Block, New England Biolabs) for 30 min at 37°C followed by a 30 min wash in fresh medium and a 2 h chase ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were grown on glass coverslips and pre-existing SNAP-tagged histones were first quenched by incubating cells with 10 µM of the non-fluorescent substrate SNAP-cell Block (New England Biolabs) for 30 min followed by a 30 min-wash in fresh medium and a 2 hr-chase ...
-
bioRxiv - Molecular Biology 2023Quote: ... pre-existing SNAP-tagged histones were first quenched by incubating cells with 10 μM of the non-fluorescent SNAP reagent (SNAP-cell Block, New England Biolabs) for 30 min at 37°C followed by a 30 min wash in fresh medium and a 2-hour chase ...
-
bioRxiv - Molecular Biology 2023Quote: ... pre-existing SNAP-tagged histones were quenched during 30 min with 10 µM of the non-fluorescent reagent SNAP-cell Block (New England Biolabs), followed by a 30-min wash in fresh medium and a 2-h chase ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ribosomes with a spytag labeled L17 subunit was used during in vitro translation system (NEB, E3313S) to generate the stalled RNC ...
-
bioRxiv - Microbiology 2024Quote: ... and pNJ-26 vector were assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB), to generate the plasmid pSAG1:EGFP-DHFR-BAG1:mCherry ...
-
bioRxiv - Neuroscience 2020Quote: ... + 5 % non-fat milk for 1 hour at room temperature before incubating with primary antibody: anti-GFP (1:1000, Biolabs) or anti-actin (1:5000 ...
-
bioRxiv - Microbiology 2024Quote: ... Single-construct plasmids expressing A-subunits were constructed via restriction digestion (NdeI and PstI, New England Biolabs) and ligation using pBAD24 (Amp+ ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 μl of PNGase F (non-reducing, NEB) was added to remove protein N-glycosylations and the sample was incubated at 50°C for 10 minutes ...
-
bioRxiv - Immunology 2023Quote: ... BFP was amplified from Tol2-lyz:BFP [26] (a gift from Anna Huttenlocher) for HiFi cloning (NEB) into the Tol2-mfap4 vector cut open with SalI (F ...
-
bioRxiv - Neuroscience 2021Quote: ... mutations were respectively inserted in the LEV-1 and UNC-29 subunits by PCR using the Q5 site-directed mutagenesis kit according to the manufacturer’s recommendations (New England Biolabs). The forward and reverse primers used were 5’- GTTCTTTGAGGCAACAGTTGG −3’ 5’- CCGTACAACAAAAACCGATCCA −3’ for G461E substitution in lev-1 cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... To perform in vitro phosphorylation 5 μg of purified GST-NL2CT (WT or S714D) fusion protein was incubated with 2.5kUnits purified catalytic subunit of PKA (NEB) supplemented with 200 μM ATP at 30°C for the indicated time points.
-
bioRxiv - Biochemistry 2021Quote: ... cDNAs encoding each of the CBAF subunits were PCR-amplified using Phusion DNA polymerase in HiFi Phusion buffer (NEB) and subcloned into pLibMam vectors using NEBuilder HiFi (NEB ...
-
bioRxiv - Biochemistry 2023Quote: Trx-linker concatemers (1 mg/mL) were incubated with 50,000 units of the catalytic subunit of cAMP-dependent protein kinase (PKA) (NEB)—which recognizes the RRAS motif within the central linker of the Trx-linker nonamer—in protein kinase buffer (50 mM Tris HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... 4.1 μl of PLPPR3 ICD (final concentration 0.075 mg/ml) was mixed with 0.2 μl purified PKA catalytic subunit (final concentration 20 000 Units; #P6000S, Biolabs), 0.8 μl phosphorylation buffer (final concentration of 25 mM HEPES ...
-
bioRxiv - Molecular Biology 2023Quote: Target sites of library-diverse were amplified by NEBNext Ultra II Q5 Master Mix (NEB, 26 cycles), and target sites from the TRIP library were amplified by GoTaq G2 Hot Start Green Master Mix (Promega ...
-
bioRxiv - Cell Biology 2021Quote: Intracellular levels of mRNA for TRAP complex subunits were estimated by RT-qPCR using Luna Universal One-Step RT-qPCR Kit (NEB) following total RNA isolation with RNeasy Mini Kit (Qiagen) ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... proteolytic subunits were removed from the expression constructs using blunt end deletion following a standard Q5 mutagenesis workflow (New England Biolabs). Additionally ...
-
bioRxiv - Biophysics 2023Quote: ... To enrich for fully assembled TC-TL complexes the expressome was purified via immobilizing the 50S subunit (ZS22) onto streptavidin magnetic beads (NEB). For this ...
-
bioRxiv - Microbiology 2024Quote: To test the binding affinity of the TBT and TBTG mRNA to the 30S ribosomal subunit we used PURExpress ΔRibosome Kit (NEB) supplemented with 5 μM of 30S ribosomal subunit and 10 μM tRNAfMet in the presence of 1.4 μM of radioactively labelled mRNA (prepared as described above by in vitro translation followed by [32P] labelling as described for the northern blot probe labelling) ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 200 µM ATP with ot without 1 µl of recombinant PKA catalytic subunit (PKAc; New England Biolabs) in manufacturer-supplied reaction buffer at 30° C for 30min with agitation ...
-
bioRxiv - Genetics 2023Quote: ... with 0.04% non- acetylated bovine serum albumin (New England Biolabs). Cells were filtered through a 70µm filter and diluted to target 8,000 cells per run ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... For each extract non USER-treated and USER-treated (NEB) libraries were built 54 ...
-
bioRxiv - Cell Biology 2021Quote: ... were subcloned into phCMV3 to express C-terminal FLAG-tagged CatSper subunits (phCMV3-CatSperd or z-Flag) using NEBuilder® HiFi DNA Assembly Kit (NEB). A stop codon was placed at the upstream of HA-encoding sequences of phCMV3 vector for FLAG-tagged CatSper subunit cloning.
-
bioRxiv - Neuroscience 2022Quote: ... The non-15N 4R tau used for small-scale chemical in vitro crosslinking was phosphorylated using cAMP-dependent Protein Kinase (PKA, catalytic subunit, New England Biolabs #P6000S) according to manufacturer guidelines (25uL reaction at 30°C for 2 hours with 200 μM ATP ...
-
bioRxiv - Cell Biology 2020Quote: ... where the Emp24 transmembrane domain (residues 173-193) was replaced by 26 leucines using Gibson assembly (New England Biolabs). To construct pSP-FLAG-Cp ...
-
bioRxiv - Plant Biology 2021Quote: ... The two sgRNA cassettes were digested out of pAtU6-26-SK using the restrict enzymes by SpeI and NheI (New England Biolabs) and subcloned into pCAMBIA1300-35S-Cas9 to generate pCAMBIA1300-AtU6-26-sgRNA1-AtU6-26-sgRNA2-35S-Cas9 ...
-
bioRxiv - Plant Biology 2022Quote: ... The entry module pGG-B-AtU6-26-BRI1-2-C and pGG-A-AtU6-26-BRI1-3-B were generated by annealing oligos for each gRNA and ligating into BbsI-digested (New England Biolabs) Golden Gate entry vectors described in (66) ...
-
bioRxiv - Neuroscience 2023Quote: ... pJFRC18-8XLexAop2-RGS2(Δ1-53)::CRY2(PHR)::T2A::CIBN::eGFP::CaaX and pJFRC18-8XLexAop2-RGS2(Δ1-53)::CRY2(PHR)(D387A)::T2A::CIBN::eGFP::CaaX were generated by cloning the PiGM cassette into pJFRC18-8XLexAop2-mCD8::GFP 26 cut with XhoI and XbaI (NEB). For zebrafish expression ...
-
bioRxiv - Systems Biology 2023Quote: ... Whole metagenome sequencing libraries were prepared from 26 µL of DNA solution using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs). The DNA was purified and size selected to remove excess adaptors and adaptor dimers using Ampure XP beads (Beckman Coulter Life Sciences) ...
-
bioRxiv - Neuroscience 2019Quote: ... Digoxigenin (DIG)-labelled anti-sense and sense RNA probes corresponding to GPA2 and GPB5 subunits were synthesized using the HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs, Whitby, ON, Canada). Fluorescence in situ hybridization (FISH ...
-
bioRxiv - Microbiology 2021Quote: ... the SAG1 3’UTR was amplified from pNJ-26 and cloned into the tagging plasmid to replace DHFR 3’UTR by Gibson assembly (NEB, E5520S). BAG1-mCherry GCaMP6f reporter tachyzoites were co-transfected with 10 μg of pSAG1::CAS9-U6::sgDHFR 3’UTR and 2 μg of PCR amplified P2A-mTagBFP2-HXGPRT flanked with 40 bp homology regions ...